Incidental Mutation 'R0553:Zbtb24'
ID 45290
Institutional Source Beutler Lab
Gene Symbol Zbtb24
Ensembl Gene ENSMUSG00000019826
Gene Name zinc finger and BTB domain containing 24
Synonyms ZNF450
MMRRC Submission 038745-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0553 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 41450383-41465574 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 41451997 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 293 (A293V)
Ref Sequence ENSEMBL: ENSMUSP00000150197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080771] [ENSMUST00000213797] [ENSMUST00000216656]
AlphaFold Q80X44
Predicted Effect possibly damaging
Transcript: ENSMUST00000080771
AA Change: A293V

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000079592
Gene: ENSMUSG00000019826
AA Change: A293V

DomainStartEndE-ValueType
BTB 37 133 5.81e-26 SMART
AT_hook 159 171 2.23e-1 SMART
low complexity region 248 260 N/A INTRINSIC
ZnF_C2H2 293 315 8.67e-1 SMART
ZnF_C2H2 321 343 4.87e-4 SMART
ZnF_C2H2 349 371 6.42e-4 SMART
ZnF_C2H2 377 399 2.99e-4 SMART
ZnF_C2H2 405 427 9.44e-2 SMART
ZnF_C2H2 433 455 3.26e-5 SMART
ZnF_C2H2 461 483 2.36e-2 SMART
ZnF_C2H2 489 511 7.9e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000213797
AA Change: A293V

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214159
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215881
Predicted Effect possibly damaging
Transcript: ENSMUST00000216656
AA Change: A293V

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
Meta Mutation Damage Score 0.1604 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: This gene encodes a protein containing eight C2H2-type zinc fingers and a BTB domain. Expression of this gene is induced by bone morphogenetic protein-2 signaling. Mutation of the related gene in humans causes immunodeficiency-centromeric instability-facial anomalies syndrome-2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a deletion in the BTB domain exhibit embryonic lethality between E4.5 and E9.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,682,686 I729V probably damaging Het
9530002B09Rik A T 4: 122,702,335 M120L unknown Het
Adamts13 T A 2: 26,991,334 C774* probably null Het
Amh A G 10: 80,806,176 probably benign Het
Ccdc173 C A 2: 69,789,441 R8L probably damaging Het
Cd40 G A 2: 165,070,741 R204Q probably benign Het
Clhc1 A C 11: 29,561,366 probably benign Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Flg2 A T 3: 93,203,584 H973L unknown Het
Fut2 T A 7: 45,651,274 I25F probably damaging Het
Galnt7 T C 8: 57,552,430 probably benign Het
Gm438 T A 4: 144,777,415 I389L possibly damaging Het
Gm7534 T C 4: 134,202,518 T159A possibly damaging Het
Gm8909 G T 17: 36,168,057 P100Q probably damaging Het
Gmppb A T 9: 108,049,797 M56L probably benign Het
Grm3 C A 5: 9,570,048 A399S probably benign Het
Hey2 G A 10: 30,840,489 probably benign Het
Ift172 A G 5: 31,275,842 probably benign Het
Kcnh5 C A 12: 75,137,673 C92F probably benign Het
Kdm1a T C 4: 136,555,298 D229G probably damaging Het
Klf11 C G 12: 24,655,090 P164R probably benign Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Krtcap3 T C 5: 31,251,803 V6A probably benign Het
Ltbr A C 6: 125,313,388 probably null Het
Mmp17 T G 5: 129,598,670 S298A probably benign Het
Nacc2 T A 2: 26,089,590 E278V possibly damaging Het
Olfr175-ps1 A T 16: 58,824,155 Y185N probably damaging Het
Olfr875 T A 9: 37,773,331 I224N probably benign Het
Otop2 C T 11: 115,329,462 A376V probably damaging Het
Pdia2 T C 17: 26,196,243 E504G probably damaging Het
Pdzph1 C T 17: 58,922,727 V979M probably damaging Het
Pou5f1 A G 17: 35,509,477 K86R possibly damaging Het
Ptprq A G 10: 107,710,627 F269L probably benign Het
Rb1 A T 14: 73,211,712 C659* probably null Het
Rnf8 T C 17: 29,621,639 probably null Het
Rras T G 7: 45,020,556 I137M probably benign Het
Slc38a9 A T 13: 112,714,198 H372L probably damaging Het
Spata9 T C 13: 75,977,779 probably null Het
Tas2r115 T C 6: 132,737,959 T10A probably benign Het
Ttn T C 2: 76,798,893 E12621G probably damaging Het
Unc80 A T 1: 66,506,669 I460F probably damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Other mutations in Zbtb24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01312:Zbtb24 APN 10 41451889 missense possibly damaging 0.63
R7189_Zbtb24_504 UTSW 10 41464476 missense probably benign 0.00
BB009:Zbtb24 UTSW 10 41451508 missense probably benign
BB019:Zbtb24 UTSW 10 41451508 missense probably benign
R0485:Zbtb24 UTSW 10 41464536 missense probably damaging 0.96
R0662:Zbtb24 UTSW 10 41462279 missense probably damaging 1.00
R0927:Zbtb24 UTSW 10 41451436 missense probably benign 0.43
R1164:Zbtb24 UTSW 10 41464527 missense probably damaging 1.00
R1456:Zbtb24 UTSW 10 41464993 missense possibly damaging 0.46
R1464:Zbtb24 UTSW 10 41455079 missense probably damaging 1.00
R1464:Zbtb24 UTSW 10 41455079 missense probably damaging 1.00
R1873:Zbtb24 UTSW 10 41451127 missense probably benign 0.28
R2299:Zbtb24 UTSW 10 41464581 missense probably damaging 1.00
R2371:Zbtb24 UTSW 10 41451268 missense probably damaging 1.00
R4280:Zbtb24 UTSW 10 41464920 missense probably benign 0.34
R4281:Zbtb24 UTSW 10 41464920 missense probably benign 0.34
R4593:Zbtb24 UTSW 10 41451957 missense possibly damaging 0.89
R4991:Zbtb24 UTSW 10 41456618 splice site probably null
R5262:Zbtb24 UTSW 10 41464560 nonsense probably null
R5371:Zbtb24 UTSW 10 41451541 missense probably benign 0.01
R5393:Zbtb24 UTSW 10 41464582 missense probably damaging 1.00
R5428:Zbtb24 UTSW 10 41464788 missense probably benign
R5785:Zbtb24 UTSW 10 41451853 missense probably benign 0.00
R6033:Zbtb24 UTSW 10 41464401 missense probably damaging 1.00
R6033:Zbtb24 UTSW 10 41464401 missense probably damaging 1.00
R6961:Zbtb24 UTSW 10 41455175 missense probably damaging 1.00
R7189:Zbtb24 UTSW 10 41464476 missense probably benign 0.00
R7407:Zbtb24 UTSW 10 41464779 missense possibly damaging 0.94
R7932:Zbtb24 UTSW 10 41451508 missense probably benign
R8074:Zbtb24 UTSW 10 41451232 missense probably damaging 1.00
R9365:Zbtb24 UTSW 10 41456544 missense probably damaging 0.98
R9484:Zbtb24 UTSW 10 41451433 missense probably benign 0.01
Z1176:Zbtb24 UTSW 10 41455190 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGAGAACTTTGACCCCAAGGCTG -3'
(R):5'- AGACCATCTCCTCATCTGCACACTG -3'

Sequencing Primer
(F):5'- CCAAGGCTGGGGATGGAC -3'
(R):5'- CACTGGAGATAGTACCTACTGTG -3'
Posted On 2013-06-11