Incidental Mutation 'IGL02991:Lbr'
ID452902
Institutional Source Beutler Lab
Gene Symbol Lbr
Ensembl Gene ENSMUSG00000004880
Gene Namelamin B receptor
Synonyms
Accession Numbers

Genbank: NM_133815.2; Ensembl: ENSMUST00000005003

Is this an essential gene? Probably essential (E-score: 0.825) question?
Stock #IGL02991 (G1)
Quality Score162
Status Validated
Chromosome1
Chromosomal Location181815335-181843046 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 181821552 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 334 (Y334C)
Ref Sequence ENSEMBL: ENSMUSP00000005003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005003]
Predicted Effect probably damaging
Transcript: ENSMUST00000005003
AA Change: Y334C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005003
Gene: ENSMUSG00000004880
AA Change: Y334C

DomainStartEndE-ValueType
TUDOR 4 62 6.7e-9 SMART
low complexity region 63 101 N/A INTRINSIC
low complexity region 111 121 N/A INTRINSIC
Pfam:ERG4_ERG24 194 626 4.6e-161 PFAM
Pfam:DUF1295 452 617 1.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192075
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194302
Predicted Effect unknown
Transcript: ENSMUST00000194415
AA Change: Y92C
Meta Mutation Damage Score 0.4259 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ERG4/ERG24 family. It localized in the nuclear envelope inner membrane and anchors the lamina and the heterochromatin to the membrane. It may mediate interaction between chromatin and lamin B. Mutations of this gene has been associated with autosomal recessive HEM/Greenberg skeletal dysplasia. Alternative splicing occurs at this locus and two transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in abnormal skin and hair and impair growth. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Gene trapped(17) Spontaneous(6)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Adam23 T C 1: 63,547,819 probably null Het
Aptx C A 4: 40,686,687 G199C probably damaging Het
Asap2 T C 12: 21,249,293 probably benign Het
Atp11b A G 3: 35,826,991 T566A probably benign Het
Bcas3 C T 11: 85,457,887 Q202* probably null Het
Cacna1h C A 17: 25,391,312 R740L possibly damaging Het
Casp8 T A 1: 58,827,279 N146K probably benign Het
Ccdc63 T C 5: 122,108,212 M549V probably benign Het
Cdc45 C T 16: 18,798,729 M200I probably benign Het
Cdh20 T C 1: 104,934,247 S51P probably benign Het
Chd7 T C 4: 8,828,398 M1113T possibly damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Crb1 ACC AC 1: 139,237,084 probably null Het
Crb1 CG C 1: 139,237,086 probably null Het
Cxcl11 C T 5: 92,361,310 R28H probably damaging Het
Defb40 C T 8: 18,975,103 C29Y probably damaging Het
Fam105a T C 15: 27,658,302 S211G possibly damaging Het
Fcna G C 2: 25,630,681 probably benign Het
Fen1 A T 19: 10,200,662 D139E probably benign Het
Frem3 A G 8: 80,668,882 E1846G probably damaging Het
Gria2 T A 3: 80,707,809 K455* probably null Het
Hmcn1 A T 1: 150,738,658 N1332K possibly damaging Het
Htr5b C T 1: 121,528,027 V55M probably benign Het
Ighv6-5 A T 12: 114,416,695 N86K probably benign Het
Il4ra T C 7: 125,575,661 V347A possibly damaging Het
Itih5 A G 2: 10,251,351 E876G probably benign Het
Itpkb A T 1: 180,327,714 probably benign Het
Lrfn2 T C 17: 49,070,704 L271P probably damaging Het
Lss T A 10: 76,543,911 probably benign Het
Map1a T C 2: 121,301,610 V731A probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mob3b T A 4: 35,083,805 Q128L probably benign Het
Mog T C 17: 37,023,199 M1V probably null Het
Mrpl4 A G 9: 21,008,605 Y284C probably damaging Het
Mtus2 T G 5: 148,313,500 V310G probably damaging Het
Mup11 ACAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCA 4: 60,662,276 probably benign Het
Olfr972 T A 9: 39,874,066 S264T probably benign Het
Olfr979 T C 9: 40,000,402 Y275C probably damaging Het
Orc3 T G 4: 34,593,083 Q328P probably damaging Het
Pcdhb20 G T 18: 37,506,211 G597C probably damaging Het
Pdxdc1 A G 16: 13,857,396 I334T probably damaging Het
Ppef2 C T 5: 92,235,900 W450* probably null Het
Proz G A 8: 13,073,490 E254K probably benign Het
Psma6 T C 12: 55,407,572 probably benign Het
Rbm12 C T 2: 156,095,560 probably benign Het
Ryr2 A G 13: 11,761,306 V1115A probably damaging Het
Sfxn5 G T 6: 85,289,208 N102K possibly damaging Het
Sgo2a G T 1: 58,015,355 probably benign Het
Slc14a2 A T 18: 78,205,834 M1K probably null Het
Spag5 T A 11: 78,314,251 L621M probably damaging Het
Spata31 A G 13: 64,920,719 Y227C probably benign Het
Speer4c A C 5: 15,714,216 probably benign Het
Supt6 T C 11: 78,225,353 E728G probably damaging Het
Sympk T A 7: 19,030,577 L69Q probably damaging Het
Timd4 T A 11: 46,842,147 probably benign Het
Trh G A 6: 92,243,738 R48W probably damaging Het
Trip12 C A 1: 84,738,815 D383Y probably damaging Het
Tspo2 T A 17: 48,449,986 I23F possibly damaging Het
Tspyl5 A G 15: 33,686,843 S319P probably damaging Het
Ttc25 A G 11: 100,553,872 S285G probably benign Het
Txlnb A G 10: 17,841,453 K403E probably damaging Het
Vmn2r34 C A 7: 7,672,721 C556F probably damaging Het
Vps13c C A 9: 67,913,877 A1223E probably damaging Het
Other mutations in Lbr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01585:Lbr APN 1 181825643 nonsense probably null
IGL01680:Lbr APN 1 181836194 missense probably damaging 1.00
IGL02738:Lbr APN 1 181832213 missense probably benign 0.16
IGL03048:Lbr APN 1 181838544 utr 5 prime probably benign
IGL03227:Lbr APN 1 181836055 unclassified probably null
IGL03337:Lbr APN 1 181832223 missense possibly damaging 0.92
Aconcagua UTSW 1 181828902 missense probably benign 0.02
kosciuszko UTSW 1 181825621 critical splice donor site probably null
Mont_blanc UTSW 1 181820702 missense probably damaging 1.00
seven UTSW 1 181832213 missense probably benign 0.16
1mM(1):Lbr UTSW 1 181831679 missense possibly damaging 0.65
H8562:Lbr UTSW 1 181820668 splice site probably benign
R0597:Lbr UTSW 1 181832213 missense probably benign 0.16
R1118:Lbr UTSW 1 181820668 splice site probably benign
R1727:Lbr UTSW 1 181819916 missense probably benign 0.01
R2566:Lbr UTSW 1 181836127 missense probably damaging 0.96
R3699:Lbr UTSW 1 181818920 missense probably damaging 1.00
R3854:Lbr UTSW 1 181831715 missense probably benign 0.05
R4290:Lbr UTSW 1 181820702 missense probably damaging 1.00
R4292:Lbr UTSW 1 181820702 missense probably damaging 1.00
R4293:Lbr UTSW 1 181820702 missense probably damaging 1.00
R4294:Lbr UTSW 1 181820702 missense probably damaging 1.00
R4295:Lbr UTSW 1 181820702 missense probably damaging 1.00
R4771:Lbr UTSW 1 181838421 missense probably damaging 1.00
R4890:Lbr UTSW 1 181817568 missense probably benign 0.10
R5011:Lbr UTSW 1 181819888 nonsense probably null
R5402:Lbr UTSW 1 181819961 missense probably benign 0.00
R5486:Lbr UTSW 1 181818838 critical splice donor site probably null
R5617:Lbr UTSW 1 181828902 missense probably benign 0.02
R5630:Lbr UTSW 1 181816964 unclassified probably null
R6360:Lbr UTSW 1 181832155 missense probably benign 0.00
R6575:Lbr UTSW 1 181836198 missense probably damaging 1.00
R7069:Lbr UTSW 1 181828789 missense probably damaging 1.00
R7342:Lbr UTSW 1 181825621 critical splice donor site probably null
R7590:Lbr UTSW 1 181821511 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGAGTAGTCATGGCTGCCAG -3'
(R):5'- CATTGACTGGTAGCTCCTGTG -3'

Sequencing Primer
(F):5'- AGGGCTCTGGACACAGC -3'
(R):5'- TTGAGCCCGGGGACTTAAG -3'
Posted On2017-01-24