Incidental Mutation 'IGL02991:Mob3b'
ID452911
Institutional Source Beutler Lab
Gene Symbol Mob3b
Ensembl Gene ENSMUSG00000073910
Gene NameMOB kinase activator 3B
SynonymsA430018A01Rik, MOB3B, 8430436F23Rik, Mobkl2b
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #IGL02991 (G1)
Quality Score185
Status Validated
Chromosome4
Chromosomal Location34949074-35157484 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 35083805 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 128 (Q128L)
Ref Sequence ENSEMBL: ENSMUSP00000100040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102975]
Predicted Effect probably benign
Transcript: ENSMUST00000102975
AA Change: Q128L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000100040
Gene: ENSMUSG00000073910
AA Change: Q128L

DomainStartEndE-ValueType
Mob1_phocein 33 207 1.93e-105 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155725
Meta Mutation Damage Score 0.0648 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with the yeast Mob1 protein. Yeast Mob1 binds Mps1p, a protein kinase essential for spindle pole body duplication and mitotic checkpoint regulation. This gene is located on the opposite strand as the interferon kappa precursor (IFNK) gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Adam23 T C 1: 63,547,819 probably null Het
Aptx C A 4: 40,686,687 G199C probably damaging Het
Asap2 T C 12: 21,249,293 probably benign Het
Atp11b A G 3: 35,826,991 T566A probably benign Het
Bcas3 C T 11: 85,457,887 Q202* probably null Het
Cacna1h C A 17: 25,391,312 R740L possibly damaging Het
Casp8 T A 1: 58,827,279 N146K probably benign Het
Ccdc63 T C 5: 122,108,212 M549V probably benign Het
Cdc45 C T 16: 18,798,729 M200I probably benign Het
Cdh20 T C 1: 104,934,247 S51P probably benign Het
Chd7 T C 4: 8,828,398 M1113T possibly damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Crb1 ACC AC 1: 139,237,084 probably null Het
Crb1 CG C 1: 139,237,086 probably null Het
Cxcl11 C T 5: 92,361,310 R28H probably damaging Het
Defb40 C T 8: 18,975,103 C29Y probably damaging Het
Fam105a T C 15: 27,658,302 S211G possibly damaging Het
Fcna G C 2: 25,630,681 probably benign Het
Fen1 A T 19: 10,200,662 D139E probably benign Het
Frem3 A G 8: 80,668,882 E1846G probably damaging Het
Gria2 T A 3: 80,707,809 K455* probably null Het
Hmcn1 A T 1: 150,738,658 N1332K possibly damaging Het
Htr5b C T 1: 121,528,027 V55M probably benign Het
Ighv6-5 A T 12: 114,416,695 N86K probably benign Het
Il4ra T C 7: 125,575,661 V347A possibly damaging Het
Itih5 A G 2: 10,251,351 E876G probably benign Het
Itpkb A T 1: 180,327,714 probably benign Het
Lbr T C 1: 181,821,552 Y334C probably damaging Het
Lrfn2 T C 17: 49,070,704 L271P probably damaging Het
Lss T A 10: 76,543,911 probably benign Het
Map1a T C 2: 121,301,610 V731A probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mog T C 17: 37,023,199 M1V probably null Het
Mrpl4 A G 9: 21,008,605 Y284C probably damaging Het
Mtus2 T G 5: 148,313,500 V310G probably damaging Het
Mup11 ACAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCA 4: 60,662,276 probably benign Het
Olfr972 T A 9: 39,874,066 S264T probably benign Het
Olfr979 T C 9: 40,000,402 Y275C probably damaging Het
Orc3 T G 4: 34,593,083 Q328P probably damaging Het
Pcdhb20 G T 18: 37,506,211 G597C probably damaging Het
Pdxdc1 A G 16: 13,857,396 I334T probably damaging Het
Ppef2 C T 5: 92,235,900 W450* probably null Het
Proz G A 8: 13,073,490 E254K probably benign Het
Psma6 T C 12: 55,407,572 probably benign Het
Rbm12 C T 2: 156,095,560 probably benign Het
Ryr2 A G 13: 11,761,306 V1115A probably damaging Het
Sfxn5 G T 6: 85,289,208 N102K possibly damaging Het
Sgo2a G T 1: 58,015,355 probably benign Het
Slc14a2 A T 18: 78,205,834 M1K probably null Het
Spag5 T A 11: 78,314,251 L621M probably damaging Het
Spata31 A G 13: 64,920,719 Y227C probably benign Het
Speer4c A C 5: 15,714,216 probably benign Het
Supt6 T C 11: 78,225,353 E728G probably damaging Het
Sympk T A 7: 19,030,577 L69Q probably damaging Het
Timd4 T A 11: 46,842,147 probably benign Het
Trh G A 6: 92,243,738 R48W probably damaging Het
Trip12 C A 1: 84,738,815 D383Y probably damaging Het
Tspo2 T A 17: 48,449,986 I23F possibly damaging Het
Tspyl5 A G 15: 33,686,843 S319P probably damaging Het
Ttc25 A G 11: 100,553,872 S285G probably benign Het
Txlnb A G 10: 17,841,453 K403E probably damaging Het
Vmn2r34 C A 7: 7,672,721 C556F probably damaging Het
Vps13c C A 9: 67,913,877 A1223E probably damaging Het
Other mutations in Mob3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02198:Mob3b APN 4 35083983 missense probably damaging 1.00
R0016:Mob3b UTSW 4 35083947 missense probably benign 0.02
R0408:Mob3b UTSW 4 35083991 missense probably damaging 1.00
R1542:Mob3b UTSW 4 35084046 missense possibly damaging 0.88
R1686:Mob3b UTSW 4 34985910 splice site probably benign
R1723:Mob3b UTSW 4 34954026 missense probably damaging 0.99
R1726:Mob3b UTSW 4 34954028 missense probably benign 0.09
R2013:Mob3b UTSW 4 35083922 missense probably benign 0.00
R2112:Mob3b UTSW 4 35083795 missense probably damaging 0.97
R5992:Mob3b UTSW 4 35084069 missense probably benign 0.43
R6043:Mob3b UTSW 4 34985993 missense probably benign 0.05
R6418:Mob3b UTSW 4 34954049 critical splice acceptor site probably null
R7117:Mob3b UTSW 4 34985914 critical splice donor site probably null
R7170:Mob3b UTSW 4 35083839 missense probably damaging 1.00
R7714:Mob3b UTSW 4 35083872 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACCTCCGACCATTTCAATCAG -3'
(R):5'- CTCATCTACGGCACCATCTG -3'

Sequencing Primer
(F):5'- GAAGCCCTAATGTGTGCTATCTAG -3'
(R):5'- ACCATCTGTGAGTTCTGCACTGAG -3'
Posted On2017-01-24