Incidental Mutation 'IGL02991:Il4ra'
ID452923
Institutional Source Beutler Lab
Gene Symbol Il4ra
Ensembl Gene ENSMUSG00000030748
Gene Nameinterleukin 4 receptor, alpha
SynonymsIl4r, IL-4 receptor alpha chain, CD124
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #IGL02991 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location125552120-125579474 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125575661 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 347 (V347A)
Ref Sequence ENSEMBL: ENSMUSP00000033004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033004] [ENSMUST00000206846]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033004
AA Change: V347A

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000033004
Gene: ENSMUSG00000030748
AA Change: V347A

DomainStartEndE-ValueType
Pfam:IL4Ra_N 28 122 9.9e-39 PFAM
FN3 124 211 3.14e0 SMART
low complexity region 369 385 N/A INTRINSIC
low complexity region 562 574 N/A INTRINSIC
low complexity region 617 630 N/A INTRINSIC
low complexity region 635 647 N/A INTRINSIC
low complexity region 674 683 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205394
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206681
Predicted Effect probably benign
Transcript: ENSMUST00000206846
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of the interleukin-4 receptor, a type I transmembrane protein that can bind interleukin 4 and interleukin 13 to regulate IgE production. The encoded protein also can bind interleukin 4 to promote differentiation of Th2 cells. A soluble form of the encoded protein can be produced by proteolysis of the membrane-bound protein, and this soluble form can inhibit IL4-mediated cell proliferation and IL5 upregulation by T-cells. Allelic variations in this gene have been associated with atopy, a condition that can manifest itself as allergic rhinitis, sinusitus, asthma, or eczema. Polymorphisms in this gene are also associated with resistance to human immunodeficiency virus type-1 infection. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2012]
PHENOTYPE: Nullizygous mice exhibit reduced T helper 2 cell response to N. brasiliensis infection. Homozygotes for a null allele also display severe susceptibility to S. mansoni infection, enhanced carcinogen-induced intestinal tumour initiation, and altered control of chronic Leishmania major infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Adam23 T C 1: 63,547,819 probably null Het
Aptx C A 4: 40,686,687 G199C probably damaging Het
Asap2 T C 12: 21,249,293 probably benign Het
Atp11b A G 3: 35,826,991 T566A probably benign Het
Bcas3 C T 11: 85,457,887 Q202* probably null Het
Cacna1h C A 17: 25,391,312 R740L possibly damaging Het
Casp8 T A 1: 58,827,279 N146K probably benign Het
Ccdc63 T C 5: 122,108,212 M549V probably benign Het
Cdc45 C T 16: 18,798,729 M200I probably benign Het
Cdh20 T C 1: 104,934,247 S51P probably benign Het
Chd7 T C 4: 8,828,398 M1113T possibly damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Crb1 ACC AC 1: 139,237,084 probably null Het
Crb1 CG C 1: 139,237,086 probably null Het
Cxcl11 C T 5: 92,361,310 R28H probably damaging Het
Defb40 C T 8: 18,975,103 C29Y probably damaging Het
Fam105a T C 15: 27,658,302 S211G possibly damaging Het
Fcna G C 2: 25,630,681 probably benign Het
Fen1 A T 19: 10,200,662 D139E probably benign Het
Frem3 A G 8: 80,668,882 E1846G probably damaging Het
Gria2 T A 3: 80,707,809 K455* probably null Het
Hmcn1 A T 1: 150,738,658 N1332K possibly damaging Het
Htr5b C T 1: 121,528,027 V55M probably benign Het
Ighv6-5 A T 12: 114,416,695 N86K probably benign Het
Itih5 A G 2: 10,251,351 E876G probably benign Het
Itpkb A T 1: 180,327,714 probably benign Het
Lbr T C 1: 181,821,552 Y334C probably damaging Het
Lrfn2 T C 17: 49,070,704 L271P probably damaging Het
Lss T A 10: 76,543,911 probably benign Het
Map1a T C 2: 121,301,610 V731A probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mob3b T A 4: 35,083,805 Q128L probably benign Het
Mog T C 17: 37,023,199 M1V probably null Het
Mrpl4 A G 9: 21,008,605 Y284C probably damaging Het
Mtus2 T G 5: 148,313,500 V310G probably damaging Het
Mup11 ACAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCA 4: 60,662,276 probably benign Het
Olfr972 T A 9: 39,874,066 S264T probably benign Het
Olfr979 T C 9: 40,000,402 Y275C probably damaging Het
Orc3 T G 4: 34,593,083 Q328P probably damaging Het
Pcdhb20 G T 18: 37,506,211 G597C probably damaging Het
Pdxdc1 A G 16: 13,857,396 I334T probably damaging Het
Ppef2 C T 5: 92,235,900 W450* probably null Het
Proz G A 8: 13,073,490 E254K probably benign Het
Psma6 T C 12: 55,407,572 probably benign Het
Rbm12 C T 2: 156,095,560 probably benign Het
Ryr2 A G 13: 11,761,306 V1115A probably damaging Het
Sfxn5 G T 6: 85,289,208 N102K possibly damaging Het
Sgo2a G T 1: 58,015,355 probably benign Het
Slc14a2 A T 18: 78,205,834 M1K probably null Het
Spag5 T A 11: 78,314,251 L621M probably damaging Het
Spata31 A G 13: 64,920,719 Y227C probably benign Het
Speer4c A C 5: 15,714,216 probably benign Het
Supt6 T C 11: 78,225,353 E728G probably damaging Het
Sympk T A 7: 19,030,577 L69Q probably damaging Het
Timd4 T A 11: 46,842,147 probably benign Het
Trh G A 6: 92,243,738 R48W probably damaging Het
Trip12 C A 1: 84,738,815 D383Y probably damaging Het
Tspo2 T A 17: 48,449,986 I23F possibly damaging Het
Tspyl5 A G 15: 33,686,843 S319P probably damaging Het
Ttc25 A G 11: 100,553,872 S285G probably benign Het
Txlnb A G 10: 17,841,453 K403E probably damaging Het
Vmn2r34 C A 7: 7,672,721 C556F probably damaging Het
Vps13c C A 9: 67,913,877 A1223E probably damaging Het
Other mutations in Il4ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00940:Il4ra APN 7 125569175 critical splice donor site probably null
IGL01067:Il4ra APN 7 125575161 missense probably benign 0.09
IGL01107:Il4ra APN 7 125575914 missense possibly damaging 0.88
IGL02224:Il4ra APN 7 125570099 splice site probably benign
IGL02249:Il4ra APN 7 125567224 missense probably benign 0.01
IGL02383:Il4ra APN 7 125571504 missense probably benign 0.06
IGL02614:Il4ra APN 7 125575790 nonsense probably null
IGL02879:Il4ra APN 7 125576897 missense possibly damaging 0.88
Haile UTSW 7 125574717 critical splice donor site probably null
Lowe UTSW 7 125567221 missense probably damaging 1.00
PIT4418001:Il4ra UTSW 7 125576338 missense probably benign 0.01
R0066:Il4ra UTSW 7 125576231 missense possibly damaging 0.80
R0127:Il4ra UTSW 7 125569070 missense probably damaging 1.00
R0148:Il4ra UTSW 7 125575537 missense probably damaging 1.00
R0238:Il4ra UTSW 7 125575199 splice site probably benign
R0239:Il4ra UTSW 7 125575199 splice site probably benign
R0884:Il4ra UTSW 7 125574663 missense probably damaging 1.00
R1102:Il4ra UTSW 7 125574717 critical splice donor site probably null
R1622:Il4ra UTSW 7 125570053 missense possibly damaging 0.87
R1773:Il4ra UTSW 7 125567182 missense possibly damaging 0.94
R4510:Il4ra UTSW 7 125576108 missense possibly damaging 0.63
R4511:Il4ra UTSW 7 125576108 missense possibly damaging 0.63
R4612:Il4ra UTSW 7 125576083 missense probably benign 0.14
R5865:Il4ra UTSW 7 125575176 missense probably benign 0.00
R5996:Il4ra UTSW 7 125567221 missense probably damaging 1.00
R6057:Il4ra UTSW 7 125571563 missense probably damaging 1.00
R6246:Il4ra UTSW 7 125576405 missense probably benign 0.00
R7218:Il4ra UTSW 7 125575778 missense probably benign 0.01
R7624:Il4ra UTSW 7 125569108 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGCAAAACTTAACCCTCAG -3'
(R):5'- TTCTCAGCCTCCAACAAGTC -3'

Sequencing Primer
(F):5'- AGCTTTACCTCTGCAGGCAC -3'
(R):5'- AAACAGGTTCTCAGTGAGCC -3'
Posted On2017-01-24