Incidental Mutation 'IGL02991:Mmp1a'
ID452928
Institutional Source Beutler Lab
Gene Symbol Mmp1a
Ensembl Gene ENSMUSG00000043089
Gene Namematrix metallopeptidase 1a (interstitial collagenase)
SynonymsMcol-A
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #IGL02991 (G1)
Quality Score214
Status Validated
Chromosome9
Chromosomal Location7464141-7476869 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) TG to TGG at 7465083 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151193 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034492] [ENSMUST00000217651]
Predicted Effect probably null
Transcript: ENSMUST00000034492
SMART Domains Protein: ENSMUSP00000034492
Gene: ENSMUSG00000043089

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:PG_binding_1 25 84 8.2e-14 PFAM
ZnMc 97 259 2.99e-44 SMART
HX 281 323 8.12e-6 SMART
HX 325 369 7.81e-8 SMART
HX 374 421 5.82e-16 SMART
HX 423 463 2.18e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000217651
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme that degrades collagens. Mice lacking the encoded protein exhibit decreased susceptibility to chemical carcinogen-induced lung tumor development and angiogenesis. This gene is located in a cluster of other matrix metalloproteinase genes on chromosome 9. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced inflammatory response following chemical induction of tumors and male mice exhibit fewer large induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Adam23 T C 1: 63,547,819 probably null Het
Aptx C A 4: 40,686,687 G199C probably damaging Het
Asap2 T C 12: 21,249,293 probably benign Het
Atp11b A G 3: 35,826,991 T566A probably benign Het
Bcas3 C T 11: 85,457,887 Q202* probably null Het
Cacna1h C A 17: 25,391,312 R740L possibly damaging Het
Casp8 T A 1: 58,827,279 N146K probably benign Het
Ccdc63 T C 5: 122,108,212 M549V probably benign Het
Cdc45 C T 16: 18,798,729 M200I probably benign Het
Cdh20 T C 1: 104,934,247 S51P probably benign Het
Chd7 T C 4: 8,828,398 M1113T possibly damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Crb1 ACC AC 1: 139,237,084 probably null Het
Crb1 CG C 1: 139,237,086 probably null Het
Cxcl11 C T 5: 92,361,310 R28H probably damaging Het
Defb40 C T 8: 18,975,103 C29Y probably damaging Het
Fam105a T C 15: 27,658,302 S211G possibly damaging Het
Fcna G C 2: 25,630,681 probably benign Het
Fen1 A T 19: 10,200,662 D139E probably benign Het
Frem3 A G 8: 80,668,882 E1846G probably damaging Het
Gria2 T A 3: 80,707,809 K455* probably null Het
Hmcn1 A T 1: 150,738,658 N1332K possibly damaging Het
Htr5b C T 1: 121,528,027 V55M probably benign Het
Ighv6-5 A T 12: 114,416,695 N86K probably benign Het
Il4ra T C 7: 125,575,661 V347A possibly damaging Het
Itih5 A G 2: 10,251,351 E876G probably benign Het
Itpkb A T 1: 180,327,714 probably benign Het
Lbr T C 1: 181,821,552 Y334C probably damaging Het
Lrfn2 T C 17: 49,070,704 L271P probably damaging Het
Lss T A 10: 76,543,911 probably benign Het
Map1a T C 2: 121,301,610 V731A probably damaging Het
Mob3b T A 4: 35,083,805 Q128L probably benign Het
Mog T C 17: 37,023,199 M1V probably null Het
Mrpl4 A G 9: 21,008,605 Y284C probably damaging Het
Mtus2 T G 5: 148,313,500 V310G probably damaging Het
Mup11 ACAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCA 4: 60,662,276 probably benign Het
Olfr972 T A 9: 39,874,066 S264T probably benign Het
Olfr979 T C 9: 40,000,402 Y275C probably damaging Het
Orc3 T G 4: 34,593,083 Q328P probably damaging Het
Pcdhb20 G T 18: 37,506,211 G597C probably damaging Het
Pdxdc1 A G 16: 13,857,396 I334T probably damaging Het
Ppef2 C T 5: 92,235,900 W450* probably null Het
Proz G A 8: 13,073,490 E254K probably benign Het
Psma6 T C 12: 55,407,572 probably benign Het
Rbm12 C T 2: 156,095,560 probably benign Het
Ryr2 A G 13: 11,761,306 V1115A probably damaging Het
Sfxn5 G T 6: 85,289,208 N102K possibly damaging Het
Sgo2a G T 1: 58,015,355 probably benign Het
Slc14a2 A T 18: 78,205,834 M1K probably null Het
Spag5 T A 11: 78,314,251 L621M probably damaging Het
Spata31 A G 13: 64,920,719 Y227C probably benign Het
Speer4c A C 5: 15,714,216 probably benign Het
Supt6 T C 11: 78,225,353 E728G probably damaging Het
Sympk T A 7: 19,030,577 L69Q probably damaging Het
Timd4 T A 11: 46,842,147 probably benign Het
Trh G A 6: 92,243,738 R48W probably damaging Het
Trip12 C A 1: 84,738,815 D383Y probably damaging Het
Tspo2 T A 17: 48,449,986 I23F possibly damaging Het
Tspyl5 A G 15: 33,686,843 S319P probably damaging Het
Ttc25 A G 11: 100,553,872 S285G probably benign Het
Txlnb A G 10: 17,841,453 K403E probably damaging Het
Vmn2r34 C A 7: 7,672,721 C556F probably damaging Het
Vps13c C A 9: 67,913,877 A1223E probably damaging Het
Other mutations in Mmp1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Mmp1a APN 9 7476259 missense probably benign 0.04
IGL02179:Mmp1a APN 9 7464273 missense probably benign 0.23
IGL02738:Mmp1a APN 9 7464301 splice site probably benign
IGL02984:Mmp1a UTSW 9 7465083 makesense probably null
IGL02988:Mmp1a UTSW 9 7465083 makesense probably null
IGL03014:Mmp1a UTSW 9 7465083 makesense probably null
IGL03050:Mmp1a UTSW 9 7465083 makesense probably null
IGL03054:Mmp1a UTSW 9 7465083 makesense probably null
IGL03055:Mmp1a UTSW 9 7465083 makesense probably null
IGL03097:Mmp1a UTSW 9 7465083 makesense probably null
IGL03098:Mmp1a UTSW 9 7465083 makesense probably null
IGL03134:Mmp1a UTSW 9 7465083 makesense probably null
IGL03138:Mmp1a UTSW 9 7465083 makesense probably null
IGL03147:Mmp1a UTSW 9 7465083 makesense probably null
R0095:Mmp1a UTSW 9 7465620 missense possibly damaging 0.51
R0095:Mmp1a UTSW 9 7465620 missense possibly damaging 0.51
R1422:Mmp1a UTSW 9 7464298 splice site probably null
R1663:Mmp1a UTSW 9 7465656 missense probably benign 0.33
R1801:Mmp1a UTSW 9 7475390 missense probably damaging 1.00
R2171:Mmp1a UTSW 9 7475356 missense probably damaging 0.99
R3415:Mmp1a UTSW 9 7464869 missense possibly damaging 0.92
R3901:Mmp1a UTSW 9 7475345 makesense probably null
R4175:Mmp1a UTSW 9 7467235 missense probably benign 0.03
R5406:Mmp1a UTSW 9 7467293 missense probably damaging 1.00
R6462:Mmp1a UTSW 9 7467038 missense probably benign 0.01
R7016:Mmp1a UTSW 9 7465083 makesense probably null
R7039:Mmp1a UTSW 9 7465083 makesense probably null
R7098:Mmp1a UTSW 9 7475937 missense probably benign 0.00
R7144:Mmp1a UTSW 9 7475318 missense probably damaging 1.00
R7196:Mmp1a UTSW 9 7476017 nonsense probably null
R7284:Mmp1a UTSW 9 7465083 makesense probably null
R7289:Mmp1a UTSW 9 7467293 missense probably damaging 1.00
R7313:Mmp1a UTSW 9 7465083 makesense probably null
R7510:Mmp1a UTSW 9 7465083 makesense probably null
R7537:Mmp1a UTSW 9 7465083 makesense probably null
R7574:Mmp1a UTSW 9 7465083 makesense probably null
R7626:Mmp1a UTSW 9 7465083 makesense probably null
X0020:Mmp1a UTSW 9 7465626 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAAACTACTACAACTTGGGC -3'
(R):5'- TGGTGTCACATCACTCCAGAC -3'

Sequencing Primer
(F):5'- TACTACAACTTGGGCAAAAACATG -3'
(R):5'- AGACTCTAAAGGCTCTCGCGATG -3'
Posted On2017-01-24