Incidental Mutation 'IGL02991:Txlnb'
ID452934
Institutional Source Beutler Lab
Gene Symbol Txlnb
Ensembl Gene ENSMUSG00000039891
Gene Nametaxilin beta
Synonyms2310001N14Rik, Mdp77
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #IGL02991 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location17796226-17845665 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 17841453 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 403 (K403E)
Ref Sequence ENSEMBL: ENSMUSP00000044936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037964]
Predicted Effect probably damaging
Transcript: ENSMUST00000037964
AA Change: K403E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044936
Gene: ENSMUSG00000039891
AA Change: K403E

DomainStartEndE-ValueType
internal_repeat_2 5 22 2.13e-6 PROSPERO
internal_repeat_1 25 93 4.27e-8 PROSPERO
low complexity region 115 128 N/A INTRINSIC
Pfam:Taxilin 145 454 3.1e-122 PFAM
low complexity region 477 491 N/A INTRINSIC
internal_repeat_2 543 560 2.13e-6 PROSPERO
low complexity region 575 591 N/A INTRINSIC
internal_repeat_1 600 659 4.27e-8 PROSPERO
Meta Mutation Damage Score 0.4864 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 95% (73/77)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Adam23 T C 1: 63,547,819 probably null Het
Aptx C A 4: 40,686,687 G199C probably damaging Het
Asap2 T C 12: 21,249,293 probably benign Het
Atp11b A G 3: 35,826,991 T566A probably benign Het
Bcas3 C T 11: 85,457,887 Q202* probably null Het
Cacna1h C A 17: 25,391,312 R740L possibly damaging Het
Casp8 T A 1: 58,827,279 N146K probably benign Het
Ccdc63 T C 5: 122,108,212 M549V probably benign Het
Cdc45 C T 16: 18,798,729 M200I probably benign Het
Cdh20 T C 1: 104,934,247 S51P probably benign Het
Chd7 T C 4: 8,828,398 M1113T possibly damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Crb1 ACC AC 1: 139,237,084 probably null Het
Crb1 CG C 1: 139,237,086 probably null Het
Cxcl11 C T 5: 92,361,310 R28H probably damaging Het
Defb40 C T 8: 18,975,103 C29Y probably damaging Het
Fam105a T C 15: 27,658,302 S211G possibly damaging Het
Fcna G C 2: 25,630,681 probably benign Het
Fen1 A T 19: 10,200,662 D139E probably benign Het
Frem3 A G 8: 80,668,882 E1846G probably damaging Het
Gria2 T A 3: 80,707,809 K455* probably null Het
Hmcn1 A T 1: 150,738,658 N1332K possibly damaging Het
Htr5b C T 1: 121,528,027 V55M probably benign Het
Ighv6-5 A T 12: 114,416,695 N86K probably benign Het
Il4ra T C 7: 125,575,661 V347A possibly damaging Het
Itih5 A G 2: 10,251,351 E876G probably benign Het
Itpkb A T 1: 180,327,714 probably benign Het
Lbr T C 1: 181,821,552 Y334C probably damaging Het
Lrfn2 T C 17: 49,070,704 L271P probably damaging Het
Lss T A 10: 76,543,911 probably benign Het
Map1a T C 2: 121,301,610 V731A probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mob3b T A 4: 35,083,805 Q128L probably benign Het
Mog T C 17: 37,023,199 M1V probably null Het
Mrpl4 A G 9: 21,008,605 Y284C probably damaging Het
Mtus2 T G 5: 148,313,500 V310G probably damaging Het
Mup11 ACAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCA 4: 60,662,276 probably benign Het
Olfr972 T A 9: 39,874,066 S264T probably benign Het
Olfr979 T C 9: 40,000,402 Y275C probably damaging Het
Orc3 T G 4: 34,593,083 Q328P probably damaging Het
Pcdhb20 G T 18: 37,506,211 G597C probably damaging Het
Pdxdc1 A G 16: 13,857,396 I334T probably damaging Het
Ppef2 C T 5: 92,235,900 W450* probably null Het
Proz G A 8: 13,073,490 E254K probably benign Het
Psma6 T C 12: 55,407,572 probably benign Het
Rbm12 C T 2: 156,095,560 probably benign Het
Ryr2 A G 13: 11,761,306 V1115A probably damaging Het
Sfxn5 G T 6: 85,289,208 N102K possibly damaging Het
Sgo2a G T 1: 58,015,355 probably benign Het
Slc14a2 A T 18: 78,205,834 M1K probably null Het
Spag5 T A 11: 78,314,251 L621M probably damaging Het
Spata31 A G 13: 64,920,719 Y227C probably benign Het
Speer4c A C 5: 15,714,216 probably benign Het
Supt6 T C 11: 78,225,353 E728G probably damaging Het
Sympk T A 7: 19,030,577 L69Q probably damaging Het
Timd4 T A 11: 46,842,147 probably benign Het
Trh G A 6: 92,243,738 R48W probably damaging Het
Trip12 C A 1: 84,738,815 D383Y probably damaging Het
Tspo2 T A 17: 48,449,986 I23F possibly damaging Het
Tspyl5 A G 15: 33,686,843 S319P probably damaging Het
Ttc25 A G 11: 100,553,872 S285G probably benign Het
Vmn2r34 C A 7: 7,672,721 C556F probably damaging Het
Vps13c C A 9: 67,913,877 A1223E probably damaging Het
Other mutations in Txlnb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Txlnb APN 10 17842963 missense probably damaging 0.98
IGL01820:Txlnb APN 10 17806858 critical splice donor site probably null
IGL02244:Txlnb APN 10 17843368 missense probably benign 0.00
IGL02247:Txlnb APN 10 17830342 missense possibly damaging 0.55
IGL02247:Txlnb APN 10 17841528 splice site probably benign
IGL02931:Txlnb APN 10 17827982 missense probably damaging 1.00
IGL03006:Txlnb APN 10 17838975 missense probably damaging 0.96
R0092:Txlnb UTSW 10 17842755 missense possibly damaging 0.91
R0800:Txlnb UTSW 10 17799492 missense possibly damaging 0.50
R0908:Txlnb UTSW 10 17799177 missense probably damaging 1.00
R1172:Txlnb UTSW 10 17842756 missense probably benign 0.23
R1174:Txlnb UTSW 10 17842756 missense probably benign 0.23
R1340:Txlnb UTSW 10 17842740 missense probably damaging 1.00
R1373:Txlnb UTSW 10 17838947 missense probably damaging 1.00
R1641:Txlnb UTSW 10 17806773 missense possibly damaging 0.55
R1680:Txlnb UTSW 10 17843233 missense probably benign 0.01
R1710:Txlnb UTSW 10 17843455 missense possibly damaging 0.90
R1741:Txlnb UTSW 10 17838947 missense probably damaging 1.00
R1955:Txlnb UTSW 10 17799420 missense probably damaging 0.98
R2031:Txlnb UTSW 10 17830314 missense possibly damaging 0.85
R4300:Txlnb UTSW 10 17827925 missense probably damaging 1.00
R4483:Txlnb UTSW 10 17838997 nonsense probably null
R4484:Txlnb UTSW 10 17838997 nonsense probably null
R4656:Txlnb UTSW 10 17815276 missense probably damaging 1.00
R4664:Txlnb UTSW 10 17843194 missense probably damaging 0.99
R4723:Txlnb UTSW 10 17799267 missense probably benign 0.02
R4974:Txlnb UTSW 10 17838969 missense probably damaging 1.00
R5291:Txlnb UTSW 10 17799396 missense possibly damaging 0.92
R5538:Txlnb UTSW 10 17838909 missense probably damaging 1.00
R5791:Txlnb UTSW 10 17799128 missense probably benign 0.01
R5967:Txlnb UTSW 10 17799420 missense probably damaging 0.98
R6144:Txlnb UTSW 10 17843166 missense probably benign 0.17
R6212:Txlnb UTSW 10 17799309 missense probably damaging 1.00
R7146:Txlnb UTSW 10 17827798 missense possibly damaging 0.81
R7171:Txlnb UTSW 10 17842984 missense probably benign 0.22
R7253:Txlnb UTSW 10 17827885 missense probably damaging 1.00
R7468:Txlnb UTSW 10 17799334 missense probably damaging 0.96
R7608:Txlnb UTSW 10 17815398 missense probably damaging 0.98
X0025:Txlnb UTSW 10 17799422 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- CTCCGGTGCAAACAAGTTCG -3'
(R):5'- ACGTCTCCCTTGAAATTCAGCC -3'

Sequencing Primer
(F):5'- TCGGGAAGAAATCGTTCCTC -3'
(R):5'- TCAGCCTATTTTCCAAACGTAATCAC -3'
Posted On2017-01-24