Incidental Mutation 'R0553:Klf11'
ID 45295
Institutional Source Beutler Lab
Gene Symbol Klf11
Ensembl Gene ENSMUSG00000020653
Gene Name Kruppel-like factor 11
Synonyms Tieg2b, D12Ertd427e, Tieg3, Tieg2
MMRRC Submission 038745-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0553 (G1)
Quality Score 181
Status Validated
Chromosome 12
Chromosomal Location 24651274-24662789 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to G at 24655090 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Arginine at position 164 (P164R)
Ref Sequence ENSEMBL: ENSMUSP00000115340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020982] [ENSMUST00000139940] [ENSMUST00000144046] [ENSMUST00000146894]
AlphaFold Q8K1S5
Predicted Effect probably benign
Transcript: ENSMUST00000020982
AA Change: P181R

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000020982
Gene: ENSMUSG00000020653
AA Change: P181R

DomainStartEndE-ValueType
low complexity region 267 275 N/A INTRINSIC
low complexity region 356 367 N/A INTRINSIC
ZnF_C2H2 384 408 5.9e-3 SMART
ZnF_C2H2 414 438 9.22e-5 SMART
ZnF_C2H2 444 466 1.38e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139940
Predicted Effect probably benign
Transcript: ENSMUST00000144046
AA Change: P164R

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000146894
AA Change: P164R

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcription factor that binds to SP1-like sequences in epsilon- and gamma-globin gene promoters. This binding inhibits cell growth and causes apoptosis. Defects in this gene are a cause of maturity-onset diabetes of the young type 7 (MODY7). Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile, show normal hematopoiesis, growth and development, and display no evidence of increased tumor formation following gamma-irradiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,682,686 I729V probably damaging Het
9530002B09Rik A T 4: 122,702,335 M120L unknown Het
Adamts13 T A 2: 26,991,334 C774* probably null Het
Amh A G 10: 80,806,176 probably benign Het
Ccdc173 C A 2: 69,789,441 R8L probably damaging Het
Cd40 G A 2: 165,070,741 R204Q probably benign Het
Clhc1 A C 11: 29,561,366 probably benign Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Flg2 A T 3: 93,203,584 H973L unknown Het
Fut2 T A 7: 45,651,274 I25F probably damaging Het
Galnt7 T C 8: 57,552,430 probably benign Het
Gm438 T A 4: 144,777,415 I389L possibly damaging Het
Gm7534 T C 4: 134,202,518 T159A possibly damaging Het
Gm8909 G T 17: 36,168,057 P100Q probably damaging Het
Gmppb A T 9: 108,049,797 M56L probably benign Het
Grm3 C A 5: 9,570,048 A399S probably benign Het
Hey2 G A 10: 30,840,489 probably benign Het
Ift172 A G 5: 31,275,842 probably benign Het
Kcnh5 C A 12: 75,137,673 C92F probably benign Het
Kdm1a T C 4: 136,555,298 D229G probably damaging Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Krtcap3 T C 5: 31,251,803 V6A probably benign Het
Ltbr A C 6: 125,313,388 probably null Het
Mmp17 T G 5: 129,598,670 S298A probably benign Het
Nacc2 T A 2: 26,089,590 E278V possibly damaging Het
Olfr175-ps1 A T 16: 58,824,155 Y185N probably damaging Het
Olfr875 T A 9: 37,773,331 I224N probably benign Het
Otop2 C T 11: 115,329,462 A376V probably damaging Het
Pdia2 T C 17: 26,196,243 E504G probably damaging Het
Pdzph1 C T 17: 58,922,727 V979M probably damaging Het
Pou5f1 A G 17: 35,509,477 K86R possibly damaging Het
Ptprq A G 10: 107,710,627 F269L probably benign Het
Rb1 A T 14: 73,211,712 C659* probably null Het
Rnf8 T C 17: 29,621,639 probably null Het
Rras T G 7: 45,020,556 I137M probably benign Het
Slc38a9 A T 13: 112,714,198 H372L probably damaging Het
Spata9 T C 13: 75,977,779 probably null Het
Tas2r115 T C 6: 132,737,959 T10A probably benign Het
Ttn T C 2: 76,798,893 E12621G probably damaging Het
Unc80 A T 1: 66,506,669 I460F probably damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Zbtb24 C T 10: 41,451,997 A293V possibly damaging Het
Other mutations in Klf11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01630:Klf11 APN 12 24660369 missense probably benign 0.01
IGL02202:Klf11 APN 12 24653632 missense probably benign 0.37
IGL02527:Klf11 APN 12 24655323 missense probably benign 0.31
IGL02964:Klf11 APN 12 24655627 missense probably damaging 1.00
R0254:Klf11 UTSW 12 24653583 missense probably damaging 1.00
R0739:Klf11 UTSW 12 24660248 missense probably damaging 1.00
R1584:Klf11 UTSW 12 24655305 missense probably damaging 1.00
R1592:Klf11 UTSW 12 24653738 missense probably damaging 1.00
R2356:Klf11 UTSW 12 24653583 missense probably damaging 1.00
R3085:Klf11 UTSW 12 24655491 missense probably benign
R4690:Klf11 UTSW 12 24655072 missense probably damaging 0.97
R5023:Klf11 UTSW 12 24655359 missense probably benign 0.00
R5483:Klf11 UTSW 12 24655411 nonsense probably null
R5528:Klf11 UTSW 12 24654930 missense probably benign 0.00
R6148:Klf11 UTSW 12 24651568 critical splice donor site probably null
R6698:Klf11 UTSW 12 24653619 missense probably damaging 1.00
R6799:Klf11 UTSW 12 24655639 missense possibly damaging 0.59
R7317:Klf11 UTSW 12 24655519 missense possibly damaging 0.59
R7384:Klf11 UTSW 12 24653743 missense probably damaging 0.97
R7440:Klf11 UTSW 12 24655491 missense probably benign
R7473:Klf11 UTSW 12 24655142 splice site probably null
R7477:Klf11 UTSW 12 24653563 missense probably benign 0.01
R7658:Klf11 UTSW 12 24653671 missense probably damaging 1.00
R9378:Klf11 UTSW 12 24655044 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CGCTGCTCTTTTGACCAAAACAACC -3'
(R):5'- ACCTTTGTCAGTGGGGAACGAAC -3'

Sequencing Primer
(F):5'- AACAACCTTTGATGTGGTGC -3'
(R):5'- ACGAACCACCGGACTTGTG -3'
Posted On 2013-06-11