Incidental Mutation 'IGL02991:Pcdhb20'
ID452952
Institutional Source Beutler Lab
Gene Symbol Pcdhb20
Ensembl Gene ENSMUSG00000046191
Gene Nameprotocadherin beta 20
SynonymsPcdhbT, Pcdhb14
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #IGL02991 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37504264-37507822 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 37506211 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 597 (G597C)
Ref Sequence ENSEMBL: ENSMUSP00000137038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052179] [ENSMUST00000059571] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably damaging
Transcript: ENSMUST00000052179
AA Change: G597C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137038
Gene: ENSMUSG00000046191
AA Change: G597C

DomainStartEndE-ValueType
Pfam:Cadherin_2 30 112 8.3e-36 PFAM
low complexity region 136 148 N/A INTRINSIC
CA 155 240 1.41e-19 SMART
CA 264 345 2.91e-21 SMART
CA 368 449 1.12e-22 SMART
CA 473 559 3.41e-27 SMART
CA 589 670 6.34e-13 SMART
Pfam:Cadherin_C_2 686 769 7.1e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000059571
SMART Domains Protein: ENSMUSP00000053326
Gene: ENSMUSG00000043313

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 45 131 4.8e-1 SMART
CA 155 240 6.58e-20 SMART
CA 264 345 1.03e-21 SMART
CA 368 449 4.21e-18 SMART
CA 473 559 3.36e-26 SMART
CA 589 670 6.69e-12 SMART
Pfam:Cadherin_C_2 686 769 1.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.7917 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Adam23 T C 1: 63,547,819 probably null Het
Aptx C A 4: 40,686,687 G199C probably damaging Het
Asap2 T C 12: 21,249,293 probably benign Het
Atp11b A G 3: 35,826,991 T566A probably benign Het
Bcas3 C T 11: 85,457,887 Q202* probably null Het
Cacna1h C A 17: 25,391,312 R740L possibly damaging Het
Casp8 T A 1: 58,827,279 N146K probably benign Het
Ccdc63 T C 5: 122,108,212 M549V probably benign Het
Cdc45 C T 16: 18,798,729 M200I probably benign Het
Cdh20 T C 1: 104,934,247 S51P probably benign Het
Chd7 T C 4: 8,828,398 M1113T possibly damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Crb1 ACC AC 1: 139,237,084 probably null Het
Crb1 CG C 1: 139,237,086 probably null Het
Cxcl11 C T 5: 92,361,310 R28H probably damaging Het
Defb40 C T 8: 18,975,103 C29Y probably damaging Het
Fam105a T C 15: 27,658,302 S211G possibly damaging Het
Fcna G C 2: 25,630,681 probably benign Het
Fen1 A T 19: 10,200,662 D139E probably benign Het
Frem3 A G 8: 80,668,882 E1846G probably damaging Het
Gria2 T A 3: 80,707,809 K455* probably null Het
Hmcn1 A T 1: 150,738,658 N1332K possibly damaging Het
Htr5b C T 1: 121,528,027 V55M probably benign Het
Ighv6-5 A T 12: 114,416,695 N86K probably benign Het
Il4ra T C 7: 125,575,661 V347A possibly damaging Het
Itih5 A G 2: 10,251,351 E876G probably benign Het
Itpkb A T 1: 180,327,714 probably benign Het
Lbr T C 1: 181,821,552 Y334C probably damaging Het
Lrfn2 T C 17: 49,070,704 L271P probably damaging Het
Lss T A 10: 76,543,911 probably benign Het
Map1a T C 2: 121,301,610 V731A probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mob3b T A 4: 35,083,805 Q128L probably benign Het
Mog T C 17: 37,023,199 M1V probably null Het
Mrpl4 A G 9: 21,008,605 Y284C probably damaging Het
Mtus2 T G 5: 148,313,500 V310G probably damaging Het
Mup11 ACAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCA 4: 60,662,276 probably benign Het
Olfr972 T A 9: 39,874,066 S264T probably benign Het
Olfr979 T C 9: 40,000,402 Y275C probably damaging Het
Orc3 T G 4: 34,593,083 Q328P probably damaging Het
Pdxdc1 A G 16: 13,857,396 I334T probably damaging Het
Ppef2 C T 5: 92,235,900 W450* probably null Het
Proz G A 8: 13,073,490 E254K probably benign Het
Psma6 T C 12: 55,407,572 probably benign Het
Rbm12 C T 2: 156,095,560 probably benign Het
Ryr2 A G 13: 11,761,306 V1115A probably damaging Het
Sfxn5 G T 6: 85,289,208 N102K possibly damaging Het
Sgo2a G T 1: 58,015,355 probably benign Het
Slc14a2 A T 18: 78,205,834 M1K probably null Het
Spag5 T A 11: 78,314,251 L621M probably damaging Het
Spata31 A G 13: 64,920,719 Y227C probably benign Het
Speer4c A C 5: 15,714,216 probably benign Het
Supt6 T C 11: 78,225,353 E728G probably damaging Het
Sympk T A 7: 19,030,577 L69Q probably damaging Het
Timd4 T A 11: 46,842,147 probably benign Het
Trh G A 6: 92,243,738 R48W probably damaging Het
Trip12 C A 1: 84,738,815 D383Y probably damaging Het
Tspo2 T A 17: 48,449,986 I23F possibly damaging Het
Tspyl5 A G 15: 33,686,843 S319P probably damaging Het
Ttc25 A G 11: 100,553,872 S285G probably benign Het
Txlnb A G 10: 17,841,453 K403E probably damaging Het
Vmn2r34 C A 7: 7,672,721 C556F probably damaging Het
Vps13c C A 9: 67,913,877 A1223E probably damaging Het
Other mutations in Pcdhb20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Pcdhb20 APN 18 37504685 missense possibly damaging 0.87
IGL01373:Pcdhb20 APN 18 37506568 missense probably benign 0.10
IGL01556:Pcdhb20 APN 18 37504799 missense possibly damaging 0.88
IGL01621:Pcdhb20 APN 18 37504807 missense possibly damaging 0.49
IGL01768:Pcdhb20 APN 18 37506715 missense possibly damaging 0.80
IGL01859:Pcdhb20 APN 18 37504563 missense probably damaging 0.98
IGL02492:Pcdhb20 APN 18 37506400 missense probably benign 0.43
IGL03057:Pcdhb20 APN 18 37504798 missense possibly damaging 0.74
R0799:Pcdhb20 UTSW 18 37505885 missense probably damaging 1.00
R1465:Pcdhb20 UTSW 18 37504697 missense probably damaging 0.99
R1465:Pcdhb20 UTSW 18 37504697 missense probably damaging 0.99
R2012:Pcdhb20 UTSW 18 37505074 missense probably damaging 0.99
R2079:Pcdhb20 UTSW 18 37505171 missense probably benign 0.07
R2350:Pcdhb20 UTSW 18 37504510 missense probably benign 0.01
R2363:Pcdhb20 UTSW 18 37505672 missense probably damaging 1.00
R2364:Pcdhb20 UTSW 18 37505938 missense probably damaging 1.00
R2870:Pcdhb20 UTSW 18 37505780 missense possibly damaging 0.82
R2870:Pcdhb20 UTSW 18 37505780 missense possibly damaging 0.82
R4060:Pcdhb20 UTSW 18 37506164 missense probably damaging 1.00
R4609:Pcdhb20 UTSW 18 37505796 missense probably benign 0.02
R4750:Pcdhb20 UTSW 18 37506131 missense possibly damaging 0.48
R4897:Pcdhb20 UTSW 18 37506245 missense possibly damaging 0.70
R4970:Pcdhb20 UTSW 18 37506771 missense probably benign 0.00
R5098:Pcdhb20 UTSW 18 37504805 missense probably damaging 1.00
R5616:Pcdhb20 UTSW 18 37504532 missense probably damaging 0.97
R5890:Pcdhb20 UTSW 18 37505233 missense probably benign 0.00
R6225:Pcdhb20 UTSW 18 37504994 missense probably damaging 1.00
R6248:Pcdhb20 UTSW 18 37506232 missense probably damaging 0.99
R6419:Pcdhb20 UTSW 18 37505555 missense probably damaging 1.00
R6814:Pcdhb20 UTSW 18 37506165 missense probably benign 0.22
R6821:Pcdhb20 UTSW 18 37506122 missense probably damaging 1.00
R6824:Pcdhb20 UTSW 18 37505699 missense probably benign 0.06
R6872:Pcdhb20 UTSW 18 37506165 missense probably benign 0.22
R7040:Pcdhb20 UTSW 18 37504717 missense probably benign 0.00
R7145:Pcdhb20 UTSW 18 37505089 missense probably damaging 1.00
R7165:Pcdhb20 UTSW 18 37505070 missense probably damaging 1.00
R7215:Pcdhb20 UTSW 18 37505386 missense probably benign 0.24
R7265:Pcdhb20 UTSW 18 37505563 missense possibly damaging 0.95
R7372:Pcdhb20 UTSW 18 37506787 missense probably benign 0.00
R7402:Pcdhb20 UTSW 18 37504952 missense probably benign 0.05
R7718:Pcdhb20 UTSW 18 37505651 missense probably damaging 1.00
R7794:Pcdhb20 UTSW 18 37504432 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCGAGTTCCAAGTGGGTGC -3'
(R):5'- TACATCTTCTTCTTGTGCAGGG -3'

Sequencing Primer
(F):5'- TTCCAAGTGGGTGCGACAGAC -3'
(R):5'- GCTGAGAGAAGCCATCCAC -3'
Posted On2017-01-24