Incidental Mutation 'IGL03098:Nvl'
ID 452965
Institutional Source Beutler Lab
Gene Symbol Nvl
Ensembl Gene ENSMUSG00000026516
Gene Name nuclear VCP-like
Synonyms 1200009I24Rik
Accession Numbers
Essential gene? Probably essential (E-score: 0.960) question?
Stock # IGL03098 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 180914703-180971769 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 180921471 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 843 (Q843K)
Ref Sequence ENSEMBL: ENSMUSP00000027797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027797]
AlphaFold Q9DBY8
PDB Structure Structure and function of the N-terminal nucleolin binding domain of nuclear valocine containing protein like 2 (NVL2) harboring a nucleolar localization signal [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000027797
AA Change: Q843K

PolyPhen 2 Score 0.374 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000027797
Gene: ENSMUSG00000026516
AA Change: Q843K

DomainStartEndE-ValueType
Pfam:Nucleolin_bd 2 72 1.9e-31 PFAM
low complexity region 90 104 N/A INTRINSIC
low complexity region 187 201 N/A INTRINSIC
low complexity region 216 230 N/A INTRINSIC
AAA 296 435 2.94e-23 SMART
low complexity region 524 540 N/A INTRINSIC
AAA 613 749 2.56e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191721
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191728
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195209
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195511
Meta Mutation Damage Score 0.3439 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 92% (44/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AAA (ATPases associated with diverse cellular activities) superfamily. Multiple transcript variants encoding different isoforms have been found for this gene. Two encoded proteins, described as major and minor isoforms, have been localized to distinct regions of the nucleus. The largest encoded protein (major isoform) has been localized to the nucleolus and shown to participate in ribosome biosynthesis (PMID: 15469983, 16782053), while the minor isoform has been localized to the nucleoplasmin. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416I08Rik TCC TCCC X: 52,692,862 (GRCm39) noncoding transcript Het
Abca15 T C 7: 119,987,499 (GRCm39) probably null Het
Adcy4 T C 14: 56,019,038 (GRCm39) Q173R probably null Het
Arhgef19 A G 4: 140,974,879 (GRCm39) D113G possibly damaging Het
Btbd6 A G 12: 112,942,038 (GRCm39) E501G probably damaging Het
Btnl2 T C 17: 34,584,190 (GRCm39) V371A probably benign Het
Cd84 G T 1: 171,700,267 (GRCm39) R128L possibly damaging Het
Cilp TGGG TGG 9: 65,187,412 (GRCm39) probably null Het
Crb1 CG C 1: 139,164,824 (GRCm39) probably null Het
Dsg3 A T 18: 20,643,422 (GRCm39) probably benign Het
Efnb2 A T 8: 8,713,420 (GRCm39) probably benign Het
Fam24b T C 7: 130,927,977 (GRCm39) S71G probably benign Het
Flacc1 G T 1: 58,730,908 (GRCm39) H49Q probably benign Het
Hgd G A 16: 37,436,607 (GRCm39) C180Y probably benign Het
Hjurp TGGG TTGCGGG 1: 88,194,002 (GRCm39) probably benign Het
Hsd17b7 C T 1: 169,780,649 (GRCm39) E320K probably damaging Het
Kcmf1 A T 6: 72,826,567 (GRCm39) M1K probably null Het
Letm2 T A 8: 26,071,745 (GRCm39) T386S possibly damaging Het
Lvrn A T 18: 47,014,477 (GRCm39) probably null Het
Mmp1a TG TGG 9: 7,465,083 (GRCm38) probably null Het
Nid2 G A 14: 19,856,006 (GRCm39) D1244N probably damaging Het
Obi1 T C 14: 104,716,253 (GRCm39) I707V possibly damaging Het
Or1e30 T G 11: 73,678,529 (GRCm39) I255S probably benign Het
Pi4ka A T 16: 17,143,891 (GRCm39) I726N probably damaging Het
Rab25 A T 3: 88,449,567 (GRCm39) C209S probably damaging Het
Rgs6 A T 12: 83,032,150 (GRCm39) I21F probably damaging Het
Rnf10 T C 5: 115,410,426 (GRCm39) D16G probably damaging Het
Rnmt G A 18: 68,439,073 (GRCm39) V61M probably damaging Het
Rrs1 GCTC GC 1: 9,616,328 (GRCm39) probably null Het
Scd4 A T 19: 44,321,931 (GRCm39) M1L possibly damaging Het
Speer4c1 A C 5: 15,919,214 (GRCm39) probably benign Het
Sptb A G 12: 76,668,273 (GRCm39) I608T probably damaging Het
Sstr5 A G 17: 25,710,251 (GRCm39) V326A probably benign Het
Sugct T C 13: 17,846,321 (GRCm39) D62G probably damaging Het
Thada C G 17: 84,641,569 (GRCm39) D1306H possibly damaging Het
Thap1 C G 8: 26,652,498 (GRCm39) P79A probably benign Het
Tra2a G A 6: 49,225,969 (GRCm39) S157L probably damaging Het
Trappc10 C T 10: 78,050,520 (GRCm39) R307Q probably damaging Het
Trim9 A G 12: 70,327,467 (GRCm39) I390T possibly damaging Het
Usp24 T C 4: 106,228,230 (GRCm39) V765A probably benign Het
Wdr90 C A 17: 26,078,961 (GRCm39) probably benign Het
Ybey A T 10: 76,304,078 (GRCm39) C41* probably null Het
Other mutations in Nvl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Nvl APN 1 180,932,690 (GRCm39) missense probably damaging 1.00
IGL00943:Nvl APN 1 180,929,199 (GRCm39) missense possibly damaging 0.72
IGL01956:Nvl APN 1 180,962,509 (GRCm39) missense probably benign 0.00
IGL02657:Nvl APN 1 180,934,541 (GRCm39) missense probably damaging 1.00
Nineveh UTSW 1 180,964,471 (GRCm39) missense probably benign 0.00
nubia UTSW 1 180,939,899 (GRCm39) missense probably benign 0.19
P0047:Nvl UTSW 1 180,939,867 (GRCm39) missense probably damaging 1.00
R0003:Nvl UTSW 1 180,941,698 (GRCm39) missense probably damaging 1.00
R0114:Nvl UTSW 1 180,947,956 (GRCm39) missense probably benign 0.19
R0265:Nvl UTSW 1 180,962,395 (GRCm39) missense probably damaging 0.96
R0928:Nvl UTSW 1 180,921,467 (GRCm39) missense probably benign 0.00
R1398:Nvl UTSW 1 180,924,691 (GRCm39) splice site probably benign
R1470:Nvl UTSW 1 180,966,827 (GRCm39) missense probably damaging 1.00
R1470:Nvl UTSW 1 180,966,827 (GRCm39) missense probably damaging 1.00
R1529:Nvl UTSW 1 180,936,724 (GRCm39) critical splice donor site probably null
R1934:Nvl UTSW 1 180,926,693 (GRCm39) missense probably damaging 0.96
R2176:Nvl UTSW 1 180,962,639 (GRCm39) splice site probably benign
R2351:Nvl UTSW 1 180,958,357 (GRCm39) missense probably benign 0.03
R4415:Nvl UTSW 1 180,932,679 (GRCm39) missense probably benign
R4570:Nvl UTSW 1 180,971,647 (GRCm39) missense probably benign 0.03
R4720:Nvl UTSW 1 180,929,152 (GRCm39) missense probably damaging 1.00
R4888:Nvl UTSW 1 180,945,191 (GRCm39) missense probably damaging 1.00
R5026:Nvl UTSW 1 180,932,720 (GRCm39) missense probably damaging 1.00
R5507:Nvl UTSW 1 180,962,601 (GRCm39) missense probably damaging 0.98
R5785:Nvl UTSW 1 180,966,863 (GRCm39) missense probably damaging 1.00
R5983:Nvl UTSW 1 180,964,471 (GRCm39) missense probably benign 0.00
R6143:Nvl UTSW 1 180,962,560 (GRCm39) missense probably benign 0.01
R6532:Nvl UTSW 1 180,971,708 (GRCm39) splice site probably null
R6821:Nvl UTSW 1 180,954,535 (GRCm39) nonsense probably null
R7062:Nvl UTSW 1 180,939,899 (GRCm39) missense probably benign 0.19
R7247:Nvl UTSW 1 180,939,851 (GRCm39) critical splice donor site probably null
R7358:Nvl UTSW 1 180,962,601 (GRCm39) missense probably damaging 0.98
R7665:Nvl UTSW 1 180,962,509 (GRCm39) missense probably benign 0.18
R7795:Nvl UTSW 1 180,924,722 (GRCm39) missense probably benign 0.00
R7931:Nvl UTSW 1 180,936,720 (GRCm39) splice site probably benign
R8185:Nvl UTSW 1 180,971,739 (GRCm39) unclassified probably benign
R8806:Nvl UTSW 1 180,922,619 (GRCm39) missense probably benign 0.01
R8933:Nvl UTSW 1 180,966,638 (GRCm39) missense probably benign 0.00
R8975:Nvl UTSW 1 180,958,001 (GRCm39) missense probably benign
R9249:Nvl UTSW 1 180,962,593 (GRCm39) missense probably damaging 1.00
R9584:Nvl UTSW 1 180,958,431 (GRCm39) missense probably benign
R9586:Nvl UTSW 1 180,932,635 (GRCm39) critical splice donor site probably null
X0067:Nvl UTSW 1 180,966,723 (GRCm39) missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- TATCAGCCCACACTAGCAGATG -3'
(R):5'- ACTTCCTCTTGTACGGCAAC -3'

Sequencing Primer
(F):5'- GCAGATGTGGTTTTACTAACACAGCC -3'
(R):5'- TTGTACGGCAACCCCAGTC -3'
Posted On 2017-01-24