Incidental Mutation 'R0553:Spata9'
ID 45297
Institutional Source Beutler Lab
Gene Symbol Spata9
Ensembl Gene ENSMUSG00000021590
Gene Name spermatogenesis associated 9
Synonyms
MMRRC Submission 038745-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock # R0553 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 75967150-75998972 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 75977779 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000022081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022081] [ENSMUST00000225553]
AlphaFold Q9D9R3
Predicted Effect probably null
Transcript: ENSMUST00000022081
SMART Domains Protein: ENSMUSP00000022081
Gene: ENSMUSG00000021590

DomainStartEndE-ValueType
Pfam:SPATA9 1 252 5e-140 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223744
Predicted Effect probably benign
Transcript: ENSMUST00000225553
Meta Mutation Damage Score 0.9481 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,682,686 I729V probably damaging Het
9530002B09Rik A T 4: 122,702,335 M120L unknown Het
Adamts13 T A 2: 26,991,334 C774* probably null Het
Amh A G 10: 80,806,176 probably benign Het
Ccdc173 C A 2: 69,789,441 R8L probably damaging Het
Cd40 G A 2: 165,070,741 R204Q probably benign Het
Clhc1 A C 11: 29,561,366 probably benign Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Flg2 A T 3: 93,203,584 H973L unknown Het
Fut2 T A 7: 45,651,274 I25F probably damaging Het
Galnt7 T C 8: 57,552,430 probably benign Het
Gm438 T A 4: 144,777,415 I389L possibly damaging Het
Gm7534 T C 4: 134,202,518 T159A possibly damaging Het
Gm8909 G T 17: 36,168,057 P100Q probably damaging Het
Gmppb A T 9: 108,049,797 M56L probably benign Het
Grm3 C A 5: 9,570,048 A399S probably benign Het
Hey2 G A 10: 30,840,489 probably benign Het
Ift172 A G 5: 31,275,842 probably benign Het
Kcnh5 C A 12: 75,137,673 C92F probably benign Het
Kdm1a T C 4: 136,555,298 D229G probably damaging Het
Klf11 C G 12: 24,655,090 P164R probably benign Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Krtcap3 T C 5: 31,251,803 V6A probably benign Het
Ltbr A C 6: 125,313,388 probably null Het
Mmp17 T G 5: 129,598,670 S298A probably benign Het
Nacc2 T A 2: 26,089,590 E278V possibly damaging Het
Olfr175-ps1 A T 16: 58,824,155 Y185N probably damaging Het
Olfr875 T A 9: 37,773,331 I224N probably benign Het
Otop2 C T 11: 115,329,462 A376V probably damaging Het
Pdia2 T C 17: 26,196,243 E504G probably damaging Het
Pdzph1 C T 17: 58,922,727 V979M probably damaging Het
Pou5f1 A G 17: 35,509,477 K86R possibly damaging Het
Ptprq A G 10: 107,710,627 F269L probably benign Het
Rb1 A T 14: 73,211,712 C659* probably null Het
Rnf8 T C 17: 29,621,639 probably null Het
Rras T G 7: 45,020,556 I137M probably benign Het
Slc38a9 A T 13: 112,714,198 H372L probably damaging Het
Tas2r115 T C 6: 132,737,959 T10A probably benign Het
Ttn T C 2: 76,798,893 E12621G probably damaging Het
Unc80 A T 1: 66,506,669 I460F probably damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Zbtb24 C T 10: 41,451,997 A293V possibly damaging Het
Other mutations in Spata9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01728:Spata9 APN 13 75993074 missense probably benign 0.16
IGL02422:Spata9 APN 13 75993074 missense probably benign 0.06
IGL02886:Spata9 APN 13 75977734 missense probably damaging 0.98
damocles UTSW 13 75977779 critical splice donor site probably null
R0437:Spata9 UTSW 13 75998495 missense possibly damaging 0.51
R1760:Spata9 UTSW 13 75998524 missense probably benign 0.16
R1800:Spata9 UTSW 13 75977641 missense probably benign
R2571:Spata9 UTSW 13 75967761 start gained probably benign
R2696:Spata9 UTSW 13 75977776 missense probably benign 0.32
R4621:Spata9 UTSW 13 75967882 missense possibly damaging 0.71
R5988:Spata9 UTSW 13 75968117 missense probably benign 0.06
R7487:Spata9 UTSW 13 75967840 missense possibly damaging 0.93
R7590:Spata9 UTSW 13 75977652 missense possibly damaging 0.86
R8218:Spata9 UTSW 13 75977773 missense probably benign 0.00
R8273:Spata9 UTSW 13 75977547 splice site probably benign
R8316:Spata9 UTSW 13 75977771 missense possibly damaging 0.86
Z1176:Spata9 UTSW 13 75993099 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCGCCTTAGCCAAGATCAACCG -3'
(R):5'- GGCAATTTACCTGTGCCTGTCCTAC -3'

Sequencing Primer
(F):5'- GTGGGACGCTCATTCAAGG -3'
(R):5'- tcccaatgggtgagggag -3'
Posted On 2013-06-11