Incidental Mutation 'R0553:Slc38a9'
ID 45298
Institutional Source Beutler Lab
Gene Symbol Slc38a9
Ensembl Gene ENSMUSG00000047789
Gene Name solute carrier family 38, member 9
Synonyms
MMRRC Submission 038745-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.243) question?
Stock # R0553 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 112660751-112738749 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 112714198 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 372 (H372L)
Ref Sequence ENSEMBL: ENSMUSP00000052172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052514]
AlphaFold Q8BGD6
Predicted Effect probably damaging
Transcript: ENSMUST00000052514
AA Change: H372L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052172
Gene: ENSMUSG00000047789
AA Change: H372L

DomainStartEndE-ValueType
Pfam:Aa_trans 114 253 4.5e-17 PFAM
Pfam:Aa_trans 266 560 2.5e-16 PFAM
Meta Mutation Damage Score 0.9415 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,682,686 I729V probably damaging Het
9530002B09Rik A T 4: 122,702,335 M120L unknown Het
Adamts13 T A 2: 26,991,334 C774* probably null Het
Amh A G 10: 80,806,176 probably benign Het
Ccdc173 C A 2: 69,789,441 R8L probably damaging Het
Cd40 G A 2: 165,070,741 R204Q probably benign Het
Clhc1 A C 11: 29,561,366 probably benign Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Flg2 A T 3: 93,203,584 H973L unknown Het
Fut2 T A 7: 45,651,274 I25F probably damaging Het
Galnt7 T C 8: 57,552,430 probably benign Het
Gm438 T A 4: 144,777,415 I389L possibly damaging Het
Gm7534 T C 4: 134,202,518 T159A possibly damaging Het
Gm8909 G T 17: 36,168,057 P100Q probably damaging Het
Gmppb A T 9: 108,049,797 M56L probably benign Het
Grm3 C A 5: 9,570,048 A399S probably benign Het
Hey2 G A 10: 30,840,489 probably benign Het
Ift172 A G 5: 31,275,842 probably benign Het
Kcnh5 C A 12: 75,137,673 C92F probably benign Het
Kdm1a T C 4: 136,555,298 D229G probably damaging Het
Klf11 C G 12: 24,655,090 P164R probably benign Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Krtcap3 T C 5: 31,251,803 V6A probably benign Het
Ltbr A C 6: 125,313,388 probably null Het
Mmp17 T G 5: 129,598,670 S298A probably benign Het
Nacc2 T A 2: 26,089,590 E278V possibly damaging Het
Olfr175-ps1 A T 16: 58,824,155 Y185N probably damaging Het
Olfr875 T A 9: 37,773,331 I224N probably benign Het
Otop2 C T 11: 115,329,462 A376V probably damaging Het
Pdia2 T C 17: 26,196,243 E504G probably damaging Het
Pdzph1 C T 17: 58,922,727 V979M probably damaging Het
Pou5f1 A G 17: 35,509,477 K86R possibly damaging Het
Ptprq A G 10: 107,710,627 F269L probably benign Het
Rb1 A T 14: 73,211,712 C659* probably null Het
Rnf8 T C 17: 29,621,639 probably null Het
Rras T G 7: 45,020,556 I137M probably benign Het
Spata9 T C 13: 75,977,779 probably null Het
Tas2r115 T C 6: 132,737,959 T10A probably benign Het
Ttn T C 2: 76,798,893 E12621G probably damaging Het
Unc80 A T 1: 66,506,669 I460F probably damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Zbtb24 C T 10: 41,451,997 A293V possibly damaging Het
Other mutations in Slc38a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Slc38a9 APN 13 112701618 missense probably damaging 1.00
IGL01950:Slc38a9 APN 13 112695253 missense probably damaging 1.00
IGL01955:Slc38a9 APN 13 112695418 splice site probably benign
IGL02352:Slc38a9 APN 13 112690186 missense probably benign 0.10
IGL02359:Slc38a9 APN 13 112690186 missense probably benign 0.10
IGL02407:Slc38a9 APN 13 112690243 missense probably benign
IGL02511:Slc38a9 APN 13 112698007 missense possibly damaging 0.47
IGL02588:Slc38a9 APN 13 112697977 splice site probably null
IGL03278:Slc38a9 APN 13 112689518 splice site probably benign
R0126:Slc38a9 UTSW 13 112729257 missense possibly damaging 0.52
R0558:Slc38a9 UTSW 13 112729196 critical splice acceptor site probably null
R0699:Slc38a9 UTSW 13 112723289 missense probably damaging 1.00
R1036:Slc38a9 UTSW 13 112701659 splice site probably benign
R1142:Slc38a9 UTSW 13 112714210 missense probably damaging 1.00
R1344:Slc38a9 UTSW 13 112690180 missense probably benign 0.20
R1418:Slc38a9 UTSW 13 112690180 missense probably benign 0.20
R4223:Slc38a9 UTSW 13 112714248 critical splice donor site probably null
R4344:Slc38a9 UTSW 13 112729215 missense probably benign 0.02
R4824:Slc38a9 UTSW 13 112723298 missense probably damaging 0.98
R4872:Slc38a9 UTSW 13 112689564 missense probably damaging 1.00
R5841:Slc38a9 UTSW 13 112695322 missense possibly damaging 0.76
R5844:Slc38a9 UTSW 13 112731501 missense probably damaging 1.00
R6039:Slc38a9 UTSW 13 112669697 missense probably damaging 1.00
R6039:Slc38a9 UTSW 13 112669697 missense probably damaging 1.00
R6151:Slc38a9 UTSW 13 112689376 missense probably damaging 1.00
R6166:Slc38a9 UTSW 13 112695267 missense possibly damaging 0.96
R6175:Slc38a9 UTSW 13 112703559 nonsense probably null
R6324:Slc38a9 UTSW 13 112726100 missense probably benign 0.01
R6747:Slc38a9 UTSW 13 112690180 missense probably benign 0.20
R6920:Slc38a9 UTSW 13 112701526 missense possibly damaging 0.63
R7342:Slc38a9 UTSW 13 112669591 start gained probably benign
R7592:Slc38a9 UTSW 13 112695355 missense probably damaging 0.99
R7787:Slc38a9 UTSW 13 112689346 missense probably damaging 0.99
R7860:Slc38a9 UTSW 13 112731614 missense probably benign
R8742:Slc38a9 UTSW 13 112729284 missense probably damaging 1.00
R8799:Slc38a9 UTSW 13 112703602 missense probably damaging 1.00
R8824:Slc38a9 UTSW 13 112701487 missense probably benign
R8846:Slc38a9 UTSW 13 112723280 nonsense probably null
R9112:Slc38a9 UTSW 13 112714243 missense probably damaging 0.99
R9221:Slc38a9 UTSW 13 112689376 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGACCACACAGACTGCTCACC -3'
(R):5'- TCCAGCATTATCATTTGTGCTGCTAAGT -3'

Sequencing Primer
(F):5'- ACCGTGAGGGACCTGATTAC -3'
(R):5'- acccacttgcttatttattgcc -3'
Posted On 2013-06-11