Incidental Mutation 'IGL03098:Adcy4'
ID452992
Institutional Source Beutler Lab
Gene Symbol Adcy4
Ensembl Gene ENSMUSG00000022220
Gene Nameadenylate cyclase 4
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #IGL03098 (G1)
Quality Score83
Status Validated
Chromosome14
Chromosomal Location55769057-55784095 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55781581 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 173 (Q173R)
Ref Sequence ENSEMBL: ENSMUSP00000130530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002398] [ENSMUST00000002398] [ENSMUST00000022830] [ENSMUST00000168716] [ENSMUST00000170223] [ENSMUST00000178399] [ENSMUST00000227031] [ENSMUST00000228476]
Predicted Effect probably null
Transcript: ENSMUST00000002398
AA Change: Q173R

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000002398
Gene: ENSMUSG00000022220
AA Change: Q173R

DomainStartEndE-ValueType
low complexity region 28 48 N/A INTRINSIC
low complexity region 66 80 N/A INTRINSIC
low complexity region 145 161 N/A INTRINSIC
CYCc 218 426 1.56e-62 SMART
Pfam:DUF1053 479 581 2.4e-35 PFAM
transmembrane domain 607 629 N/A INTRINSIC
transmembrane domain 661 683 N/A INTRINSIC
transmembrane domain 717 739 N/A INTRINSIC
transmembrane domain 746 768 N/A INTRINSIC
transmembrane domain 792 809 N/A INTRINSIC
CYCc 835 1057 4.46e-40 SMART
Predicted Effect probably null
Transcript: ENSMUST00000002398
AA Change: Q173R

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000002398
Gene: ENSMUSG00000022220
AA Change: Q173R

DomainStartEndE-ValueType
low complexity region 28 48 N/A INTRINSIC
low complexity region 66 80 N/A INTRINSIC
low complexity region 145 161 N/A INTRINSIC
CYCc 218 426 1.56e-62 SMART
Pfam:DUF1053 479 581 2.4e-35 PFAM
transmembrane domain 607 629 N/A INTRINSIC
transmembrane domain 661 683 N/A INTRINSIC
transmembrane domain 717 739 N/A INTRINSIC
transmembrane domain 746 768 N/A INTRINSIC
transmembrane domain 792 809 N/A INTRINSIC
CYCc 835 1057 4.46e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000022830
SMART Domains Protein: ENSMUSP00000022830
Gene: ENSMUSG00000022221

DomainStartEndE-ValueType
Pfam:Pkinase 22 288 2.8e-38 PFAM
Pfam:Pkinase_Tyr 22 288 3e-34 PFAM
Pfam:RHIM 408 458 2.4e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168716
SMART Domains Protein: ENSMUSP00000126306
Gene: ENSMUSG00000022221

DomainStartEndE-ValueType
Pfam:Pkinase 1 223 1.2e-30 PFAM
Pfam:Pkinase_Tyr 1 224 3.1e-27 PFAM
Pfam:RHIM 344 395 2.4e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000170223
AA Change: Q173R

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000130530
Gene: ENSMUSG00000022220
AA Change: Q173R

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
transmembrane domain 61 80 N/A INTRINSIC
transmembrane domain 92 114 N/A INTRINSIC
transmembrane domain 119 138 N/A INTRINSIC
transmembrane domain 145 162 N/A INTRINSIC
transmembrane domain 172 194 N/A INTRINSIC
CYCc 218 426 1.56e-62 SMART
Pfam:DUF1053 479 581 1.6e-24 PFAM
transmembrane domain 607 629 N/A INTRINSIC
transmembrane domain 661 683 N/A INTRINSIC
transmembrane domain 717 739 N/A INTRINSIC
transmembrane domain 746 768 N/A INTRINSIC
transmembrane domain 792 809 N/A INTRINSIC
CYCc 835 1057 4.46e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178399
SMART Domains Protein: ENSMUSP00000137278
Gene: ENSMUSG00000022221

DomainStartEndE-ValueType
Pfam:Pkinase 1 223 1.2e-30 PFAM
Pfam:Pkinase_Tyr 1 224 3.1e-27 PFAM
Pfam:RHIM 344 395 2.4e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226361
Predicted Effect probably benign
Transcript: ENSMUST00000227031
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228077
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228175
Predicted Effect probably benign
Transcript: ENSMUST00000228476
Meta Mutation Damage Score 0.3439 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 92% (44/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of adenylate cyclases, which are membrane-associated enzymes that catalyze the formation of the secondary messenger cyclic adenosine monophosphate (cAMP). Mouse studies show that adenylate cyclase 4, along with adenylate cyclases 2 and 3, is expressed in olfactory cilia, suggesting that several different adenylate cyclases may couple to olfactory receptors and that there may be multiple receptor-mediated mechanisms for the generation of cAMP signals. Alternative splicing results in transcript variants. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for disruptions of this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Abca15 T C 7: 120,388,276 probably null Het
Als2cr12 G T 1: 58,691,749 H49Q probably benign Het
Arhgef19 A G 4: 141,247,568 D113G possibly damaging Het
Btbd6 A G 12: 112,978,418 E501G probably damaging Het
Btnl2 T C 17: 34,365,216 V371A probably benign Het
Cd84 G T 1: 171,872,700 R128L possibly damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Crb1 CG C 1: 139,237,086 probably null Het
Dsg3 A T 18: 20,510,365 probably benign Het
Efnb2 A T 8: 8,663,420 probably benign Het
Fam24b T C 7: 131,326,248 S71G probably benign Het
Hgd G A 16: 37,616,245 C180Y probably benign Het
Hjurp TGGG TTGCGGG 1: 88,266,280 probably benign Het
Hsd17b7 C T 1: 169,953,080 E320K probably damaging Het
Kcmf1 A T 6: 72,849,584 M1K probably null Het
Letm2 T A 8: 25,581,729 T386S possibly damaging Het
Lvrn A T 18: 46,881,410 probably null Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nid2 G A 14: 19,805,938 D1244N probably damaging Het
Nvl G T 1: 181,093,906 Q843K probably benign Het
Olfr390 T G 11: 73,787,703 I255S probably benign Het
Pi4ka A T 16: 17,326,027 I726N probably damaging Het
Rab25 A T 3: 88,542,260 C209S probably damaging Het
Rgs6 A T 12: 82,985,376 I21F probably damaging Het
Rnf10 T C 5: 115,272,367 D16G probably damaging Het
Rnf219 T C 14: 104,478,817 I707V possibly damaging Het
Rnmt G A 18: 68,306,002 V61M probably damaging Het
Rrs1 GCTC GC 1: 9,546,103 probably null Het
Scd4 A T 19: 44,333,492 M1L possibly damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Sptb A G 12: 76,621,499 I608T probably damaging Het
Sstr5 A G 17: 25,491,277 V326A probably benign Het
Sugct T C 13: 17,671,736 D62G probably damaging Het
Thada C G 17: 84,334,141 D1306H possibly damaging Het
Thap1 C G 8: 26,162,470 P79A probably benign Het
Tra2a G A 6: 49,249,035 S157L probably damaging Het
Trappc10 C T 10: 78,214,686 R307Q probably damaging Het
Trim9 A G 12: 70,280,693 I390T possibly damaging Het
Usp24 T C 4: 106,371,033 V765A probably benign Het
Wdr90 C A 17: 25,859,987 probably benign Het
Ybey A T 10: 76,468,244 C41* probably null Het
Other mutations in Adcy4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Adcy4 APN 14 55773663 splice site probably null
IGL02406:Adcy4 APN 14 55770047 missense possibly damaging 0.45
IGL02503:Adcy4 APN 14 55771505 missense probably damaging 1.00
IGL02543:Adcy4 APN 14 55769170 missense probably benign
IGL02616:Adcy4 APN 14 55783514 unclassified probably null
IGL03002:Adcy4 APN 14 55773556 missense probably benign 0.31
IGL03026:Adcy4 APN 14 55778010 missense probably damaging 1.00
IGL03190:Adcy4 APN 14 55779053 missense probably damaging 1.00
IGL03247:Adcy4 APN 14 55770096 missense probably damaging 1.00
stressed UTSW 14 55779099 intron probably null
R0098:Adcy4 UTSW 14 55769827 missense possibly damaging 0.78
R0102:Adcy4 UTSW 14 55771533 missense probably benign 0.29
R0396:Adcy4 UTSW 14 55772288 missense probably benign 0.00
R0482:Adcy4 UTSW 14 55774572 critical splice acceptor site probably null
R0634:Adcy4 UTSW 14 55781597 missense probably benign
R0691:Adcy4 UTSW 14 55772647 splice site probably benign
R0704:Adcy4 UTSW 14 55772756 missense probably benign
R0815:Adcy4 UTSW 14 55783599 missense probably damaging 1.00
R0863:Adcy4 UTSW 14 55783599 missense probably damaging 1.00
R1446:Adcy4 UTSW 14 55770023 critical splice donor site probably null
R1462:Adcy4 UTSW 14 55778308 missense possibly damaging 0.78
R1462:Adcy4 UTSW 14 55778308 missense possibly damaging 0.78
R1463:Adcy4 UTSW 14 55778939 missense probably damaging 1.00
R1624:Adcy4 UTSW 14 55781927 missense possibly damaging 0.68
R1799:Adcy4 UTSW 14 55771472 missense probably benign 0.01
R1878:Adcy4 UTSW 14 55769905 missense probably damaging 0.96
R2007:Adcy4 UTSW 14 55778313 missense possibly damaging 0.45
R2156:Adcy4 UTSW 14 55769170 missense probably benign 0.09
R2425:Adcy4 UTSW 14 55778017 missense probably damaging 0.99
R2517:Adcy4 UTSW 14 55781946 missense probably damaging 1.00
R3882:Adcy4 UTSW 14 55774546 missense probably benign 0.27
R4021:Adcy4 UTSW 14 55775178 intron probably null
R4022:Adcy4 UTSW 14 55775178 intron probably null
R4411:Adcy4 UTSW 14 55769443 missense probably damaging 1.00
R4530:Adcy4 UTSW 14 55779028 missense probably damaging 1.00
R4560:Adcy4 UTSW 14 55778950 unclassified probably null
R4704:Adcy4 UTSW 14 55775025 missense possibly damaging 0.91
R4780:Adcy4 UTSW 14 55775036 missense probably benign 0.07
R4860:Adcy4 UTSW 14 55781927 missense possibly damaging 0.68
R4860:Adcy4 UTSW 14 55781927 missense possibly damaging 0.68
R4868:Adcy4 UTSW 14 55773722 missense probably benign
R4890:Adcy4 UTSW 14 55779029 missense probably damaging 1.00
R4920:Adcy4 UTSW 14 55779029 missense probably damaging 1.00
R4948:Adcy4 UTSW 14 55779029 missense probably damaging 1.00
R4952:Adcy4 UTSW 14 55779029 missense probably damaging 1.00
R4953:Adcy4 UTSW 14 55779029 missense probably damaging 1.00
R4987:Adcy4 UTSW 14 55773477 missense probably benign 0.01
R4991:Adcy4 UTSW 14 55773465 missense probably benign 0.03
R5080:Adcy4 UTSW 14 55772375 missense probably damaging 0.98
R5620:Adcy4 UTSW 14 55772367 nonsense probably null
R5652:Adcy4 UTSW 14 55773443 missense probably benign
R5726:Adcy4 UTSW 14 55783661 missense probably damaging 1.00
R5910:Adcy4 UTSW 14 55779013 missense probably damaging 1.00
R5958:Adcy4 UTSW 14 55779099 intron probably null
R6280:Adcy4 UTSW 14 55779043 missense probably damaging 1.00
R6318:Adcy4 UTSW 14 55769224 missense probably damaging 1.00
R6598:Adcy4 UTSW 14 55770045 missense probably benign 0.03
R6947:Adcy4 UTSW 14 55778391 missense possibly damaging 0.92
R7012:Adcy4 UTSW 14 55779919 missense possibly damaging 0.95
R7147:Adcy4 UTSW 14 55779725 missense probably damaging 1.00
R7386:Adcy4 UTSW 14 55778327 missense probably damaging 1.00
R7414:Adcy4 UTSW 14 55781633 missense probably benign 0.15
R7431:Adcy4 UTSW 14 55772672 missense probably benign 0.01
R7490:Adcy4 UTSW 14 55770433 missense possibly damaging 0.66
R7552:Adcy4 UTSW 14 55773465 missense probably benign 0.00
R7672:Adcy4 UTSW 14 55780905 missense probably benign 0.14
R8003:Adcy4 UTSW 14 55781635 missense probably benign 0.00
R8042:Adcy4 UTSW 14 55775239 missense probably benign 0.01
R8100:Adcy4 UTSW 14 55772265 nonsense probably null
X0025:Adcy4 UTSW 14 55770391 missense probably damaging 1.00
Z1088:Adcy4 UTSW 14 55780956 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CCTCTTCTGACAAAGGTAGGC -3'
(R):5'- TCAAATTTAGACCCTGGGCG -3'

Sequencing Primer
(F):5'- CTTCTGACAAAGGTAGGCATGGTG -3'
(R):5'- ACATCACGGGCATTCAGCTTC -3'
Posted On2017-01-24