Incidental Mutation 'IGL03098:Hgd'
ID452995
Institutional Source Beutler Lab
Gene Symbol Hgd
Ensembl Gene ENSMUSG00000022821
Gene Namehomogentisate 1, 2-dioxygenase
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #IGL03098 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location37580153-37632020 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 37616245 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 180 (C180Y)
Ref Sequence ENSEMBL: ENSMUSP00000125492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159787] [ENSMUST00000160847]
Predicted Effect probably benign
Transcript: ENSMUST00000159787
AA Change: C139Y

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000160847
AA Change: C180Y

PolyPhen 2 Score 0.443 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125492
Gene: ENSMUSG00000022821
AA Change: C180Y

DomainStartEndE-ValueType
Pfam:HgmA 5 434 2e-225 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162918
Meta Mutation Damage Score 0.8733 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 92% (44/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme homogentisate 1,2 dioxygenase. This enzyme is involved in the catabolism of the amino acids tyrosine and phenylalanine. Mutations in this gene are the cause of the autosomal recessive metabolism disorder alkaptonuria.[provided by RefSeq, May 2010]
PHENOTYPE: Mutations in this gene result in high levels of urinary homogentisic acid. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Abca15 T C 7: 120,388,276 probably null Het
Adcy4 T C 14: 55,781,581 Q173R probably null Het
Als2cr12 G T 1: 58,691,749 H49Q probably benign Het
Arhgef19 A G 4: 141,247,568 D113G possibly damaging Het
Btbd6 A G 12: 112,978,418 E501G probably damaging Het
Btnl2 T C 17: 34,365,216 V371A probably benign Het
Cd84 G T 1: 171,872,700 R128L possibly damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Crb1 CG C 1: 139,237,086 probably null Het
Dsg3 A T 18: 20,510,365 probably benign Het
Efnb2 A T 8: 8,663,420 probably benign Het
Fam24b T C 7: 131,326,248 S71G probably benign Het
Hjurp TGGG TTGCGGG 1: 88,266,280 probably benign Het
Hsd17b7 C T 1: 169,953,080 E320K probably damaging Het
Kcmf1 A T 6: 72,849,584 M1K probably null Het
Letm2 T A 8: 25,581,729 T386S possibly damaging Het
Lvrn A T 18: 46,881,410 probably null Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nid2 G A 14: 19,805,938 D1244N probably damaging Het
Nvl G T 1: 181,093,906 Q843K probably benign Het
Olfr390 T G 11: 73,787,703 I255S probably benign Het
Pi4ka A T 16: 17,326,027 I726N probably damaging Het
Rab25 A T 3: 88,542,260 C209S probably damaging Het
Rgs6 A T 12: 82,985,376 I21F probably damaging Het
Rnf10 T C 5: 115,272,367 D16G probably damaging Het
Rnf219 T C 14: 104,478,817 I707V possibly damaging Het
Rnmt G A 18: 68,306,002 V61M probably damaging Het
Rrs1 GCTC GC 1: 9,546,103 probably null Het
Scd4 A T 19: 44,333,492 M1L possibly damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Sptb A G 12: 76,621,499 I608T probably damaging Het
Sstr5 A G 17: 25,491,277 V326A probably benign Het
Sugct T C 13: 17,671,736 D62G probably damaging Het
Thada C G 17: 84,334,141 D1306H possibly damaging Het
Thap1 C G 8: 26,162,470 P79A probably benign Het
Tra2a G A 6: 49,249,035 S157L probably damaging Het
Trappc10 C T 10: 78,214,686 R307Q probably damaging Het
Trim9 A G 12: 70,280,693 I390T possibly damaging Het
Usp24 T C 4: 106,371,033 V765A probably benign Het
Wdr90 C A 17: 25,859,987 probably benign Het
Ybey A T 10: 76,468,244 C41* probably null Het
Other mutations in Hgd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Hgd APN 16 37613249 missense probably damaging 1.00
IGL00851:Hgd APN 16 37631695 missense probably damaging 0.98
IGL01339:Hgd APN 16 37631730 missense possibly damaging 0.72
IGL01627:Hgd APN 16 37621925 missense probably damaging 0.96
IGL02565:Hgd APN 16 37615387 missense possibly damaging 0.88
R0346:Hgd UTSW 16 37588774 splice site probably benign
R0360:Hgd UTSW 16 37611184 splice site probably benign
R0426:Hgd UTSW 16 37588685 splice site probably benign
R0799:Hgd UTSW 16 37628609 splice site probably benign
R1178:Hgd UTSW 16 37615394 missense possibly damaging 0.95
R2921:Hgd UTSW 16 37618968 missense probably damaging 1.00
R2922:Hgd UTSW 16 37618968 missense probably damaging 1.00
R4791:Hgd UTSW 16 37631825 makesense probably null
R4859:Hgd UTSW 16 37588749 missense probably damaging 1.00
R5289:Hgd UTSW 16 37628551 missense possibly damaging 0.94
R5368:Hgd UTSW 16 37589751 missense probably benign 0.33
R5779:Hgd UTSW 16 37593371 missense probably benign 0.01
R6140:Hgd UTSW 16 37589713 missense probably benign 0.04
R6160:Hgd UTSW 16 37613298 missense probably damaging 1.00
R6636:Hgd UTSW 16 37615374 missense possibly damaging 0.75
R7196:Hgd UTSW 16 37588716 missense probably benign 0.03
R7450:Hgd UTSW 16 37624324 missense possibly damaging 0.88
R7580:Hgd UTSW 16 37618879 missense possibly damaging 0.67
R7720:Hgd UTSW 16 37593435 missense probably benign
Z1177:Hgd UTSW 16 37589719 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCAGAATACAGTTCACCCCTAAG -3'
(R):5'- TGGTAACCACTCTCTGCTTGG -3'

Sequencing Primer
(F):5'- TAAGAGACCCCTCGTTCGC -3'
(R):5'- TGTGCGCTATATTAAACAAAGCAGGC -3'
Posted On2017-01-24