Incidental Mutation 'IGL03098:Sstr5'
ID452996
Institutional Source Beutler Lab
Gene Symbol Sstr5
Ensembl Gene ENSMUSG00000050824
Gene Namesomatostatin receptor 5
SynonymsSmstr5, sst5
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #IGL03098 (G1)
Quality Score219
Status Validated
Chromosome17
Chromosomal Location25489875-25497288 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25491277 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 326 (V326A)
Ref Sequence ENSEMBL: ENSMUSP00000128787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051864] [ENSMUST00000165183]
Predicted Effect probably benign
Transcript: ENSMUST00000051864
AA Change: V326A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000051085
Gene: ENSMUSG00000050824
AA Change: V326A

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
Pfam:7TM_GPCR_Srv 44 320 1.3e-9 PFAM
Pfam:7TM_GPCR_Srx 45 317 5.5e-10 PFAM
Pfam:7TM_GPCR_Srsx 48 318 1.3e-19 PFAM
Pfam:7tm_1 54 303 3.1e-64 PFAM
Pfam:7TM_GPCR_Srw 195 321 1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165183
AA Change: V326A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000128787
Gene: ENSMUSG00000050824
AA Change: V326A

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
Pfam:7TM_GPCR_Srv 44 320 1.9e-9 PFAM
Pfam:7TM_GPCR_Srx 45 317 3.5e-10 PFAM
Pfam:7TM_GPCR_Srsx 48 318 1.3e-19 PFAM
Pfam:7tm_1 54 303 1.9e-71 PFAM
Pfam:7TM_GPCR_Srw 195 321 1e-8 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 92% (44/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Somatostatin and its related peptide cortistatin exert multiple biological actions on normal and tumoral tissue targets by interacting with somatostatin receptors (SSTRs). The protein encoded by this gene is one of the SSTRs, which is a multi-pass membrane protein and belongs to the G-protein coupled receptor 1 family. The activity of this receptor is mediated by G proteins which inhibit adenylyl cyclase, and different regions of this receptor molecule are required for the activation of different signaling pathways. A mutation in this gene results in somatostatin analog resistance. Alternatively spliced transcript variants have been identified in this gene.[provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygotes for one null allele display decreased numbers of insulin positive cells in the pancreas. Homozygotes for a second null allele have normal pancreatic islet morphology but increased insulin secretion, decreased blood insulin and glucose levels,and improved glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Abca15 T C 7: 120,388,276 probably null Het
Adcy4 T C 14: 55,781,581 Q173R probably null Het
Als2cr12 G T 1: 58,691,749 H49Q probably benign Het
Arhgef19 A G 4: 141,247,568 D113G possibly damaging Het
Btbd6 A G 12: 112,978,418 E501G probably damaging Het
Btnl2 T C 17: 34,365,216 V371A probably benign Het
Cd84 G T 1: 171,872,700 R128L possibly damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Crb1 CG C 1: 139,237,086 probably null Het
Dsg3 A T 18: 20,510,365 probably benign Het
Efnb2 A T 8: 8,663,420 probably benign Het
Fam24b T C 7: 131,326,248 S71G probably benign Het
Hgd G A 16: 37,616,245 C180Y probably benign Het
Hjurp TGGG TTGCGGG 1: 88,266,280 probably benign Het
Hsd17b7 C T 1: 169,953,080 E320K probably damaging Het
Kcmf1 A T 6: 72,849,584 M1K probably null Het
Letm2 T A 8: 25,581,729 T386S possibly damaging Het
Lvrn A T 18: 46,881,410 probably null Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nid2 G A 14: 19,805,938 D1244N probably damaging Het
Nvl G T 1: 181,093,906 Q843K probably benign Het
Olfr390 T G 11: 73,787,703 I255S probably benign Het
Pi4ka A T 16: 17,326,027 I726N probably damaging Het
Rab25 A T 3: 88,542,260 C209S probably damaging Het
Rgs6 A T 12: 82,985,376 I21F probably damaging Het
Rnf10 T C 5: 115,272,367 D16G probably damaging Het
Rnf219 T C 14: 104,478,817 I707V possibly damaging Het
Rnmt G A 18: 68,306,002 V61M probably damaging Het
Rrs1 GCTC GC 1: 9,546,103 probably null Het
Scd4 A T 19: 44,333,492 M1L possibly damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Sptb A G 12: 76,621,499 I608T probably damaging Het
Sugct T C 13: 17,671,736 D62G probably damaging Het
Thada C G 17: 84,334,141 D1306H possibly damaging Het
Thap1 C G 8: 26,162,470 P79A probably benign Het
Tra2a G A 6: 49,249,035 S157L probably damaging Het
Trappc10 C T 10: 78,214,686 R307Q probably damaging Het
Trim9 A G 12: 70,280,693 I390T possibly damaging Het
Usp24 T C 4: 106,371,033 V765A probably benign Het
Wdr90 C A 17: 25,859,987 probably benign Het
Ybey A T 10: 76,468,244 C41* probably null Het
Other mutations in Sstr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01532:Sstr5 APN 17 25491331 missense probably damaging 1.00
IGL01738:Sstr5 APN 17 25491610 missense probably damaging 1.00
IGL02212:Sstr5 APN 17 25491673 missense possibly damaging 0.93
R0402:Sstr5 UTSW 17 25492034 missense probably benign 0.15
R1576:Sstr5 UTSW 17 25491298 missense possibly damaging 0.94
R2354:Sstr5 UTSW 17 25491901 missense probably benign 0.29
R4392:Sstr5 UTSW 17 25491224 missense probably benign
R5339:Sstr5 UTSW 17 25491199 missense probably benign 0.00
R5469:Sstr5 UTSW 17 25492069 missense probably damaging 1.00
R5865:Sstr5 UTSW 17 25491244 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TCCAACTTATAGGCCTGGGG -3'
(R):5'- TCGTCAACATCGTCAACCTG -3'

Sequencing Primer
(F):5'- TGCATCTCAGCAAACTCTCATATC -3'
(R):5'- GTCAACCTGGCCTTCACG -3'
Posted On2017-01-24