Incidental Mutation 'IGL03098:Btnl2'
ID452998
Institutional Source Beutler Lab
Gene Symbol Btnl2
Ensembl Gene ENSMUSG00000024340
Gene Namebutyrophilin-like 2
SynonymsBTLN2, NG9, BTL-II, butyrophylin-like MHC class II associated
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #IGL03098 (G1)
Quality Score188
Status Validated
Chromosome17
Chromosomal Location34354822-34369493 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34365216 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 371 (V371A)
Ref Sequence ENSEMBL: ENSMUSP00000137048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025198] [ENSMUST00000178562]
Predicted Effect probably benign
Transcript: ENSMUST00000025198
AA Change: V371A

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000025198
Gene: ENSMUSG00000024340
AA Change: V371A

DomainStartEndE-ValueType
IG 35 140 2.16e-8 SMART
Blast:IG_like 150 236 4e-12 BLAST
IGv 262 343 2.89e-9 SMART
Pfam:C2-set_2 361 446 2.6e-6 PFAM
transmembrane domain 457 479 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178562
AA Change: V371A

PolyPhen 2 Score 0.198 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000137048
Gene: ENSMUSG00000024340
AA Change: V371A

DomainStartEndE-ValueType
IG 35 140 2.16e-8 SMART
Pfam:Ig_3 144 222 5.1e-4 PFAM
Pfam:C2-set_2 146 229 1.8e-6 PFAM
IGv 262 343 2.89e-9 SMART
Pfam:C2-set_2 360 446 3.7e-8 PFAM
Pfam:Ig_2 364 452 4.5e-2 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 92% (44/48)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Abca15 T C 7: 120,388,276 probably null Het
Adcy4 T C 14: 55,781,581 Q173R probably null Het
Als2cr12 G T 1: 58,691,749 H49Q probably benign Het
Arhgef19 A G 4: 141,247,568 D113G possibly damaging Het
Btbd6 A G 12: 112,978,418 E501G probably damaging Het
Cd84 G T 1: 171,872,700 R128L possibly damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Crb1 CG C 1: 139,237,086 probably null Het
Dsg3 A T 18: 20,510,365 probably benign Het
Efnb2 A T 8: 8,663,420 probably benign Het
Fam24b T C 7: 131,326,248 S71G probably benign Het
Hgd G A 16: 37,616,245 C180Y probably benign Het
Hjurp TGGG TTGCGGG 1: 88,266,280 probably benign Het
Hsd17b7 C T 1: 169,953,080 E320K probably damaging Het
Kcmf1 A T 6: 72,849,584 M1K probably null Het
Letm2 T A 8: 25,581,729 T386S possibly damaging Het
Lvrn A T 18: 46,881,410 probably null Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nid2 G A 14: 19,805,938 D1244N probably damaging Het
Nvl G T 1: 181,093,906 Q843K probably benign Het
Olfr390 T G 11: 73,787,703 I255S probably benign Het
Pi4ka A T 16: 17,326,027 I726N probably damaging Het
Rab25 A T 3: 88,542,260 C209S probably damaging Het
Rgs6 A T 12: 82,985,376 I21F probably damaging Het
Rnf10 T C 5: 115,272,367 D16G probably damaging Het
Rnf219 T C 14: 104,478,817 I707V possibly damaging Het
Rnmt G A 18: 68,306,002 V61M probably damaging Het
Rrs1 GCTC GC 1: 9,546,103 probably null Het
Scd4 A T 19: 44,333,492 M1L possibly damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Sptb A G 12: 76,621,499 I608T probably damaging Het
Sstr5 A G 17: 25,491,277 V326A probably benign Het
Sugct T C 13: 17,671,736 D62G probably damaging Het
Thada C G 17: 84,334,141 D1306H possibly damaging Het
Thap1 C G 8: 26,162,470 P79A probably benign Het
Tra2a G A 6: 49,249,035 S157L probably damaging Het
Trappc10 C T 10: 78,214,686 R307Q probably damaging Het
Trim9 A G 12: 70,280,693 I390T possibly damaging Het
Usp24 T C 4: 106,371,033 V765A probably benign Het
Wdr90 C A 17: 25,859,987 probably benign Het
Ybey A T 10: 76,468,244 C41* probably null Het
Other mutations in Btnl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02251:Btnl2 APN 17 34363239 nonsense probably null
IGL02252:Btnl2 APN 17 34365390 missense possibly damaging 0.82
IGL02651:Btnl2 APN 17 34356222 start codon destroyed probably null 1.00
IGL02892:Btnl2 APN 17 34362668 missense possibly damaging 0.61
IGL02939:Btnl2 APN 17 34361069 missense probably benign 0.02
R0504:Btnl2 UTSW 17 34358117 missense probably benign 0.17
R0706:Btnl2 UTSW 17 34368662 missense probably benign 0.21
R1460:Btnl2 UTSW 17 34366450 missense probably benign
R1590:Btnl2 UTSW 17 34361140 missense possibly damaging 0.86
R1597:Btnl2 UTSW 17 34363237 missense probably damaging 1.00
R1880:Btnl2 UTSW 17 34365363 missense possibly damaging 0.89
R3009:Btnl2 UTSW 17 34363518 missense probably damaging 0.99
R3160:Btnl2 UTSW 17 34358065 missense probably damaging 1.00
R3162:Btnl2 UTSW 17 34358065 missense probably damaging 1.00
R3722:Btnl2 UTSW 17 34358135 missense possibly damaging 0.74
R4760:Btnl2 UTSW 17 34363195 missense probably damaging 0.99
R4786:Btnl2 UTSW 17 34363348 missense probably damaging 1.00
R4839:Btnl2 UTSW 17 34365286 nonsense probably null
R5456:Btnl2 UTSW 17 34363321 missense probably benign 0.05
R6959:Btnl2 UTSW 17 34363359 missense possibly damaging 0.47
R7011:Btnl2 UTSW 17 34363513 missense probably damaging 1.00
R7650:Btnl2 UTSW 17 34358129 missense probably damaging 1.00
R7785:Btnl2 UTSW 17 34361163 missense probably benign 0.28
R7822:Btnl2 UTSW 17 34363314 missense possibly damaging 0.91
R7988:Btnl2 UTSW 17 34358275 missense possibly damaging 0.87
R8051:Btnl2 UTSW 17 34363499 missense probably damaging 1.00
R8165:Btnl2 UTSW 17 34368708 missense possibly damaging 0.62
R8272:Btnl2 UTSW 17 34356301 critical splice donor site probably null
Z1177:Btnl2 UTSW 17 34363519 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- GTAGTCTATCCTAGAAGACTGCAAC -3'
(R):5'- CGTTTGTGACCAGCAGAAGTG -3'

Sequencing Primer
(F):5'- GAAATCTTGTAGCCAGTCCCAG -3'
(R):5'- TTGTGACCAGCAGAAGTGTCTCC -3'
Posted On2017-01-24