Incidental Mutation 'IGL03098:Scd4'
ID 453002
Institutional Source Beutler Lab
Gene Symbol Scd4
Ensembl Gene ENSMUSG00000050195
Gene Name stearoyl-coenzyme A desaturase 4
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.928) question?
Stock # IGL03098 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 44333092-44346743 bp(+) (GRCm38)
Type of Mutation start codon destroyed
DNA Base Change (assembly) A to T at 44333492 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 1 (M1L)
Ref Sequence ENSEMBL: ENSMUSP00000059860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058856]
AlphaFold Q6T707
Predicted Effect possibly damaging
Transcript: ENSMUST00000058856
AA Change: M1L

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000059860
Gene: ENSMUSG00000050195
AA Change: M1L

DomainStartEndE-ValueType
transmembrane domain 65 87 N/A INTRINSIC
Pfam:FA_desaturase 91 311 7e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133314
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 92% (44/48)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Abca15 T C 7: 120,388,276 probably null Het
Adcy4 T C 14: 55,781,581 Q173R probably null Het
Als2cr12 G T 1: 58,691,749 H49Q probably benign Het
Arhgef19 A G 4: 141,247,568 D113G possibly damaging Het
Btbd6 A G 12: 112,978,418 E501G probably damaging Het
Btnl2 T C 17: 34,365,216 V371A probably benign Het
Cd84 G T 1: 171,872,700 R128L possibly damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Crb1 CG C 1: 139,237,086 probably null Het
Dsg3 A T 18: 20,510,365 probably benign Het
Efnb2 A T 8: 8,663,420 probably benign Het
Fam24b T C 7: 131,326,248 S71G probably benign Het
Hgd G A 16: 37,616,245 C180Y probably benign Het
Hjurp TGGG TTGCGGG 1: 88,266,280 probably benign Het
Hsd17b7 C T 1: 169,953,080 E320K probably damaging Het
Kcmf1 A T 6: 72,849,584 M1K probably null Het
Letm2 T A 8: 25,581,729 T386S possibly damaging Het
Lvrn A T 18: 46,881,410 probably null Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nid2 G A 14: 19,805,938 D1244N probably damaging Het
Nvl G T 1: 181,093,906 Q843K probably benign Het
Olfr390 T G 11: 73,787,703 I255S probably benign Het
Pi4ka A T 16: 17,326,027 I726N probably damaging Het
Rab25 A T 3: 88,542,260 C209S probably damaging Het
Rgs6 A T 12: 82,985,376 I21F probably damaging Het
Rnf10 T C 5: 115,272,367 D16G probably damaging Het
Rnf219 T C 14: 104,478,817 I707V possibly damaging Het
Rnmt G A 18: 68,306,002 V61M probably damaging Het
Rrs1 GCTC GC 1: 9,546,103 probably null Het
Speer4c A C 5: 15,714,216 probably benign Het
Sptb A G 12: 76,621,499 I608T probably damaging Het
Sstr5 A G 17: 25,491,277 V326A probably benign Het
Sugct T C 13: 17,671,736 D62G probably damaging Het
Thada C G 17: 84,334,141 D1306H possibly damaging Het
Thap1 C G 8: 26,162,470 P79A probably benign Het
Tra2a G A 6: 49,249,035 S157L probably damaging Het
Trappc10 C T 10: 78,214,686 R307Q probably damaging Het
Trim9 A G 12: 70,280,693 I390T possibly damaging Het
Usp24 T C 4: 106,371,033 V765A probably benign Het
Wdr90 C A 17: 25,859,987 probably benign Het
Ybey A T 10: 76,468,244 C41* probably null Het
Other mutations in Scd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02104:Scd4 APN 19 44344747 missense possibly damaging 0.54
IGL02824:Scd4 APN 19 44341259 missense probably damaging 1.00
crisco UTSW 19 44339071 missense probably benign 0.24
R0576:Scd4 UTSW 19 44341246 missense probably benign 0.00
R0655:Scd4 UTSW 19 44338968 missense possibly damaging 0.52
R1792:Scd4 UTSW 19 44337574 nonsense probably null
R1925:Scd4 UTSW 19 44341384 missense probably damaging 0.99
R1995:Scd4 UTSW 19 44334178 missense possibly damaging 0.93
R5018:Scd4 UTSW 19 44337609 missense probably benign 0.09
R5815:Scd4 UTSW 19 44337564 missense probably damaging 1.00
R6036:Scd4 UTSW 19 44344792 missense probably damaging 0.98
R6036:Scd4 UTSW 19 44344792 missense probably damaging 0.98
R6264:Scd4 UTSW 19 44338959 nonsense probably null
R6946:Scd4 UTSW 19 44333514 missense probably null 0.82
R7661:Scd4 UTSW 19 44339071 missense probably benign 0.24
R7957:Scd4 UTSW 19 44341248 missense probably benign 0.00
R8112:Scd4 UTSW 19 44337506 missense probably benign 0.00
R8226:Scd4 UTSW 19 44334133 missense probably benign 0.00
R9752:Scd4 UTSW 19 44334036 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCCTGTGCCTGGAAACAAC -3'
(R):5'- TGGACGGGAGCTTTCTTTCC -3'

Sequencing Primer
(F):5'- TGTGCCTGGAAACAACAACAC -3'
(R):5'- ACGGGAGCTTTCTTTCCTTTAAAG -3'
Posted On 2017-01-24