Incidental Mutation 'R0553:Olfr175-ps1'
ID 45301
Institutional Source Beutler Lab
Gene Symbol Olfr175-ps1
Ensembl Gene ENSMUSG00000060663
Gene Name olfactory receptor 175, pseudogene 1
Synonyms GA_x54KRFPKG5P-55026345-55025418, GA_x54KRFPKG5P-54993816-54992890, MOR184-1, Olfr174, MOR184-10P
MMRRC Submission 038745-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock # R0553 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 58823662-58826782 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 58824155 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 185 (Y185N)
Ref Sequence ENSEMBL: ENSMUSP00000150202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079955] [ENSMUST00000215069]
AlphaFold A0A140T8K4
Predicted Effect probably damaging
Transcript: ENSMUST00000079955
AA Change: Y185N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000078873
Gene: ENSMUSG00000060663
AA Change: Y185N

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.3e-52 PFAM
Pfam:7TM_GPCR_Srsx 35 305 6.8e-6 PFAM
Pfam:7tm_1 41 290 2.5e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215069
AA Change: Y185N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Meta Mutation Damage Score 0.4618 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,682,686 I729V probably damaging Het
9530002B09Rik A T 4: 122,702,335 M120L unknown Het
Adamts13 T A 2: 26,991,334 C774* probably null Het
Amh A G 10: 80,806,176 probably benign Het
Ccdc173 C A 2: 69,789,441 R8L probably damaging Het
Cd40 G A 2: 165,070,741 R204Q probably benign Het
Clhc1 A C 11: 29,561,366 probably benign Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Flg2 A T 3: 93,203,584 H973L unknown Het
Fut2 T A 7: 45,651,274 I25F probably damaging Het
Galnt7 T C 8: 57,552,430 probably benign Het
Gm438 T A 4: 144,777,415 I389L possibly damaging Het
Gm7534 T C 4: 134,202,518 T159A possibly damaging Het
Gm8909 G T 17: 36,168,057 P100Q probably damaging Het
Gmppb A T 9: 108,049,797 M56L probably benign Het
Grm3 C A 5: 9,570,048 A399S probably benign Het
Hey2 G A 10: 30,840,489 probably benign Het
Ift172 A G 5: 31,275,842 probably benign Het
Kcnh5 C A 12: 75,137,673 C92F probably benign Het
Kdm1a T C 4: 136,555,298 D229G probably damaging Het
Klf11 C G 12: 24,655,090 P164R probably benign Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Krtcap3 T C 5: 31,251,803 V6A probably benign Het
Ltbr A C 6: 125,313,388 probably null Het
Mmp17 T G 5: 129,598,670 S298A probably benign Het
Nacc2 T A 2: 26,089,590 E278V possibly damaging Het
Olfr875 T A 9: 37,773,331 I224N probably benign Het
Otop2 C T 11: 115,329,462 A376V probably damaging Het
Pdia2 T C 17: 26,196,243 E504G probably damaging Het
Pdzph1 C T 17: 58,922,727 V979M probably damaging Het
Pou5f1 A G 17: 35,509,477 K86R possibly damaging Het
Ptprq A G 10: 107,710,627 F269L probably benign Het
Rb1 A T 14: 73,211,712 C659* probably null Het
Rnf8 T C 17: 29,621,639 probably null Het
Rras T G 7: 45,020,556 I137M probably benign Het
Slc38a9 A T 13: 112,714,198 H372L probably damaging Het
Spata9 T C 13: 75,977,779 probably null Het
Tas2r115 T C 6: 132,737,959 T10A probably benign Het
Ttn T C 2: 76,798,893 E12621G probably damaging Het
Unc80 A T 1: 66,506,669 I460F probably damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Zbtb24 C T 10: 41,451,997 A293V possibly damaging Het
Other mutations in Olfr175-ps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Olfr175-ps1 APN 16 58824595 missense probably damaging 1.00
IGL01404:Olfr175-ps1 APN 16 58824595 missense probably damaging 1.00
IGL01867:Olfr175-ps1 APN 16 58823974 missense probably damaging 1.00
IGL02073:Olfr175-ps1 APN 16 58823806 missense probably benign
IGL02393:Olfr175-ps1 APN 16 58824046 missense probably damaging 0.99
IGL02474:Olfr175-ps1 APN 16 58824656 missense probably benign
IGL02548:Olfr175-ps1 APN 16 58824328 missense probably benign 0.42
IGL02948:Olfr175-ps1 APN 16 58824088 missense probably benign 0.00
PIT4504001:Olfr175-ps1 UTSW 16 58824308 missense probably benign 0.00
R1191:Olfr175-ps1 UTSW 16 58824559 missense probably benign
R1201:Olfr175-ps1 UTSW 16 58823863 missense probably damaging 0.98
R1458:Olfr175-ps1 UTSW 16 58824676 missense probably null 0.68
R1469:Olfr175-ps1 UTSW 16 58824610 missense probably benign
R1469:Olfr175-ps1 UTSW 16 58824610 missense probably benign
R1843:Olfr175-ps1 UTSW 16 58824077 missense probably damaging 0.99
R2147:Olfr175-ps1 UTSW 16 58824479 missense probably damaging 0.99
R2421:Olfr175-ps1 UTSW 16 58824346 missense probably damaging 1.00
R4370:Olfr175-ps1 UTSW 16 58824593 missense probably benign 0.00
R4621:Olfr175-ps1 UTSW 16 58824106 missense possibly damaging 0.94
R4622:Olfr175-ps1 UTSW 16 58824106 missense possibly damaging 0.94
R4623:Olfr175-ps1 UTSW 16 58824106 missense possibly damaging 0.94
R4711:Olfr175-ps1 UTSW 16 58824706 start codon destroyed probably null 0.98
R5323:Olfr175-ps1 UTSW 16 58824703 missense probably benign
R5447:Olfr175-ps1 UTSW 16 58824483 nonsense probably null
R5457:Olfr175-ps1 UTSW 16 58824433 missense probably damaging 0.97
R5546:Olfr175-ps1 UTSW 16 58824153 nonsense probably null
R5623:Olfr175-ps1 UTSW 16 58824343 missense probably benign 0.02
R5767:Olfr175-ps1 UTSW 16 58823953 missense probably benign 0.42
R6270:Olfr175-ps1 UTSW 16 58824419 missense probably damaging 1.00
R6449:Olfr175-ps1 UTSW 16 58824526 missense probably damaging 1.00
R7356:Olfr175-ps1 UTSW 16 58824355 missense probably damaging 0.99
R7521:Olfr175-ps1 UTSW 16 58823894 missense probably benign 0.00
R7638:Olfr175-ps1 UTSW 16 58824595 missense probably damaging 1.00
R7814:Olfr175-ps1 UTSW 16 58824002 missense probably damaging 0.98
R9109:Olfr175-ps1 UTSW 16 58824314 missense probably damaging 1.00
R9276:Olfr175-ps1 UTSW 16 58824371 missense probably benign 0.09
X0011:Olfr175-ps1 UTSW 16 58824663 missense probably benign
Z1176:Olfr175-ps1 UTSW 16 58824307 frame shift probably null
Z1177:Olfr175-ps1 UTSW 16 58824698 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- ATCAGTTCAAATTGGTTCCAGTTCCCA -3'
(R):5'- GATGTCCAAGAAGCTCTGCCTTCAAA -3'

Sequencing Primer
(F):5'- CAACTTTCTTCGTACAGGTGG -3'
(R):5'- GAAGCTCTGCCTTCAAATGACC -3'
Posted On 2013-06-11