Incidental Mutation 'IGL03054:Mapkbp1'
ID453012
Institutional Source Beutler Lab
Gene Symbol Mapkbp1
Ensembl Gene ENSMUSG00000033902
Gene Namemitogen-activated protein kinase binding protein 1
Synonyms2810483F24Rik, Jnkbp1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #IGL03054 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location119972699-120027408 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120015400 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 417 (T417A)
Ref Sequence ENSEMBL: ENSMUSP00000155163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066058] [ENSMUST00000229024]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066058
AA Change: T411A

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000068516
Gene: ENSMUSG00000033902
AA Change: T411A

DomainStartEndE-ValueType
WD40 80 121 8.75e-5 SMART
WD40 124 165 3.64e-2 SMART
WD40 168 205 4.62e-1 SMART
low complexity region 220 234 N/A INTRINSIC
WD40 264 301 2.65e1 SMART
WD40 332 367 1.99e0 SMART
WD40 374 422 1.29e-2 SMART
WD40 463 502 3.9e-2 SMART
WD40 505 547 2.77e-1 SMART
WD40 551 592 2.67e-1 SMART
WD40 599 639 2.21e1 SMART
WD40 642 684 5.75e-1 SMART
WD40 687 726 6.04e-8 SMART
low complexity region 736 747 N/A INTRINSIC
low complexity region 779 795 N/A INTRINSIC
low complexity region 1028 1054 N/A INTRINSIC
coiled coil region 1400 1427 N/A INTRINSIC
low complexity region 1460 1477 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128077
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137760
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184907
Predicted Effect probably damaging
Transcript: ENSMUST00000229024
AA Change: T417A

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.3462 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,886,528 T625A possibly damaging Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Aloxe3 T C 11: 69,129,607 V159A possibly damaging Het
Atp13a2 T A 4: 141,006,968 C1134S possibly damaging Het
Ccdc40 G A 11: 119,263,201 E1100K possibly damaging Het
Ceacam5 A T 7: 17,759,454 T801S possibly damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Col4a2 T C 8: 11,448,270 I1693T probably damaging Het
Crb1 CG C 1: 139,237,086 probably null Het
Dab2 G T 15: 6,418,226 probably benign Het
Dao T C 5: 114,024,902 L345P probably damaging Het
Dis3l A G 9: 64,310,440 probably null Het
Egr3 C T 14: 70,079,112 T124M probably damaging Het
Gng7 G T 10: 80,951,651 F59L probably damaging Het
Itgb4 C A 11: 116,000,340 Y1190* probably null Het
Lacc1 T C 14: 77,030,915 M319V possibly damaging Het
Mier3 C T 13: 111,686,314 probably benign Het
Mlxipl A G 5: 135,133,256 D569G possibly damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mrpl15 A G 1: 4,785,571 probably null Het
Neb T C 2: 52,271,322 N2153D probably damaging Het
Nlrp9c A G 7: 26,382,276 probably null Het
Npepps C T 11: 97,241,788 probably benign Het
Olfr338 A T 2: 36,376,932 H52L possibly damaging Het
Olfr45 T G 7: 140,691,710 S268R probably benign Het
Olfr617 C A 7: 103,584,840 H273N probably benign Het
Psmc4 T C 7: 28,047,180 Y160C probably damaging Het
Rims1 T C 1: 22,290,109 Y131C probably damaging Het
Riok1 G A 13: 38,047,315 G183D probably damaging Het
Samd9l T A 6: 3,376,023 I413F probably damaging Het
Tnfrsf22 A G 7: 143,640,795 Y132H probably damaging Het
Ttn T A 2: 76,895,760 probably benign Het
Tulp1 A G 17: 28,359,313 probably benign Het
Usp15 C A 10: 123,125,931 probably benign Het
Wdr7 G T 18: 63,825,121 probably benign Het
Other mutations in Mapkbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Mapkbp1 APN 2 120021858 missense possibly damaging 0.94
IGL01309:Mapkbp1 APN 2 120018942 missense probably damaging 1.00
IGL01728:Mapkbp1 APN 2 120023821 missense probably damaging 1.00
IGL01808:Mapkbp1 APN 2 120023169 unclassified probably null
IGL02185:Mapkbp1 APN 2 120014663 missense possibly damaging 0.58
IGL02421:Mapkbp1 APN 2 120019655 missense possibly damaging 0.95
IGL02691:Mapkbp1 APN 2 119973174 splice site probably benign
IGL03146:Mapkbp1 APN 2 119998474 splice site probably benign
IGL03387:Mapkbp1 APN 2 119998498 missense probably damaging 0.99
R0118:Mapkbp1 UTSW 2 120025215 missense probably benign 0.00
R0393:Mapkbp1 UTSW 2 120012903 splice site probably null
R0463:Mapkbp1 UTSW 2 120023151 missense probably benign 0.01
R0788:Mapkbp1 UTSW 2 120024001 missense probably benign 0.02
R0928:Mapkbp1 UTSW 2 120015368 missense probably benign 0.00
R1104:Mapkbp1 UTSW 2 120011073 splice site probably benign
R1162:Mapkbp1 UTSW 2 120025318 missense possibly damaging 0.87
R1219:Mapkbp1 UTSW 2 120019350 nonsense probably null
R1299:Mapkbp1 UTSW 2 120015404 missense probably damaging 1.00
R1300:Mapkbp1 UTSW 2 120013655 missense probably benign 0.25
R1342:Mapkbp1 UTSW 2 119998534 missense possibly damaging 0.95
R1456:Mapkbp1 UTSW 2 119973145 missense probably damaging 1.00
R1464:Mapkbp1 UTSW 2 120021261 missense probably benign
R1464:Mapkbp1 UTSW 2 120021261 missense probably benign
R1470:Mapkbp1 UTSW 2 120017820 missense probably damaging 1.00
R1470:Mapkbp1 UTSW 2 120017820 missense probably damaging 1.00
R1660:Mapkbp1 UTSW 2 120018548 missense possibly damaging 0.83
R2008:Mapkbp1 UTSW 2 120012665 missense probably damaging 1.00
R2083:Mapkbp1 UTSW 2 120015482 missense possibly damaging 0.96
R2371:Mapkbp1 UTSW 2 120010780 missense probably damaging 1.00
R2423:Mapkbp1 UTSW 2 120024590 missense probably benign 0.00
R3976:Mapkbp1 UTSW 2 120021858 missense possibly damaging 0.94
R4009:Mapkbp1 UTSW 2 120023605 missense probably benign 0.00
R4183:Mapkbp1 UTSW 2 120017865 missense probably damaging 1.00
R4246:Mapkbp1 UTSW 2 120013027 missense probably damaging 1.00
R4503:Mapkbp1 UTSW 2 120015706 missense probably damaging 1.00
R4513:Mapkbp1 UTSW 2 120023693 missense possibly damaging 0.63
R4517:Mapkbp1 UTSW 2 120025064 intron probably benign
R4742:Mapkbp1 UTSW 2 120016818 missense probably damaging 1.00
R5049:Mapkbp1 UTSW 2 120015501 splice site probably benign
R5079:Mapkbp1 UTSW 2 120013733 missense probably damaging 0.99
R5137:Mapkbp1 UTSW 2 120022181 missense probably damaging 1.00
R5255:Mapkbp1 UTSW 2 120017254 missense probably damaging 1.00
R5530:Mapkbp1 UTSW 2 120015355 missense probably benign
R5546:Mapkbp1 UTSW 2 120019243 missense probably damaging 1.00
R5634:Mapkbp1 UTSW 2 119973095 missense probably damaging 1.00
R5696:Mapkbp1 UTSW 2 120021720 splice site probably null
R5891:Mapkbp1 UTSW 2 120023932 nonsense probably null
R6263:Mapkbp1 UTSW 2 120023291 missense probably damaging 1.00
R6807:Mapkbp1 UTSW 2 120021159 missense probably damaging 0.99
R6890:Mapkbp1 UTSW 2 120015802 missense probably damaging 1.00
R7159:Mapkbp1 UTSW 2 120025132 missense possibly damaging 0.72
R7467:Mapkbp1 UTSW 2 120022188 missense probably damaging 1.00
R7536:Mapkbp1 UTSW 2 120018585 missense probably damaging 1.00
R7564:Mapkbp1 UTSW 2 120013751 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TCCTTACTGGGTGCATATATAACAG -3'
(R):5'- ATGATCAAGATTCGGGGAGCC -3'

Sequencing Primer
(F):5'- CTGGGTGCATATATAACAGTAATGTC -3'
(R):5'- TCAAGATTCGGGGAGCCAGTTC -3'
Posted On2017-01-24