Incidental Mutation 'IGL03054:Samd9l'
ID 453016
Institutional Source Beutler Lab
Gene Symbol Samd9l
Ensembl Gene ENSMUSG00000047735
Gene Name sterile alpha motif domain containing 9-like
Synonyms ESTM25
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # IGL03054 (G1)
Quality Score 210
Status Validated
Chromosome 6
Chromosomal Location 3372257-3399571 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 3376023 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 413 (I413F)
Ref Sequence ENSEMBL: ENSMUSP00000112688 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120087] [ENSMUST00000201638]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000120087
AA Change: I413F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112688
Gene: ENSMUSG00000047735
AA Change: I413F

DomainStartEndE-ValueType
SCOP:d1kw4a_ 8 75 4e-8 SMART
Blast:SAM 11 75 1e-30 BLAST
low complexity region 96 115 N/A INTRINSIC
low complexity region 385 397 N/A INTRINSIC
low complexity region 530 541 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201638
SMART Domains Protein: ENSMUSP00000144632
Gene: ENSMUSG00000047735

DomainStartEndE-ValueType
Pfam:Ste50p-SAM 10 80 1.2e-8 PFAM
Pfam:SAM_2 11 68 8.7e-6 PFAM
Pfam:SAM_1 12 71 2.5e-7 PFAM
Meta Mutation Damage Score 0.4554 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (43/44)
MGI Phenotype PHENOTYPE: Mice that are either heterozygous or homozygous for a reporter allele develop myeloid diseases and acute myelogenous leukemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416I08Rik TCC TCCC X: 52,692,862 (GRCm39) noncoding transcript Het
Acsbg3 A G 17: 57,193,528 (GRCm39) T625A possibly damaging Het
Aloxe3 T C 11: 69,020,433 (GRCm39) V159A possibly damaging Het
Atp13a2 T A 4: 140,734,279 (GRCm39) C1134S possibly damaging Het
Ccdc40 G A 11: 119,154,027 (GRCm39) E1100K possibly damaging Het
Ceacam5 A T 7: 17,493,379 (GRCm39) T801S possibly damaging Het
Cilp TGGG TGG 9: 65,187,412 (GRCm39) probably null Het
Col4a2 T C 8: 11,498,270 (GRCm39) I1693T probably damaging Het
Crb1 CG C 1: 139,164,824 (GRCm39) probably null Het
Dab2 G T 15: 6,447,707 (GRCm39) probably benign Het
Dao T C 5: 114,162,963 (GRCm39) L345P probably damaging Het
Dis3l A G 9: 64,217,722 (GRCm39) probably null Het
Egr3 C T 14: 70,316,561 (GRCm39) T124M probably damaging Het
Gng7 G T 10: 80,787,485 (GRCm39) F59L probably damaging Het
Itgb4 C A 11: 115,891,166 (GRCm39) Y1190* probably null Het
Lacc1 T C 14: 77,268,355 (GRCm39) M319V possibly damaging Het
Mapkbp1 A G 2: 119,845,881 (GRCm39) T417A probably damaging Het
Mier3 C T 13: 111,822,848 (GRCm39) probably benign Het
Mlxipl A G 5: 135,162,110 (GRCm39) D569G possibly damaging Het
Mmp1a TG TGG 9: 7,465,083 (GRCm38) probably null Het
Mrpl15 A G 1: 4,855,794 (GRCm39) probably null Het
Neb T C 2: 52,161,334 (GRCm39) N2153D probably damaging Het
Nlrp9c A G 7: 26,081,701 (GRCm39) probably null Het
Npepps C T 11: 97,132,614 (GRCm39) probably benign Het
Or13a17 T G 7: 140,271,623 (GRCm39) S268R probably benign Het
Or1j10 A T 2: 36,266,944 (GRCm39) H52L possibly damaging Het
Or52z12 C A 7: 103,234,047 (GRCm39) H273N probably benign Het
Psmc4 T C 7: 27,746,605 (GRCm39) Y160C probably damaging Het
Rims1 T C 1: 22,360,333 (GRCm39) Y131C probably damaging Het
Riok1 G A 13: 38,231,291 (GRCm39) G183D probably damaging Het
Tnfrsf22 A G 7: 143,194,532 (GRCm39) Y132H probably damaging Het
Ttn T A 2: 76,726,104 (GRCm39) probably benign Het
Tulp1 A G 17: 28,578,287 (GRCm39) probably benign Het
Usp15 C A 10: 122,961,836 (GRCm39) probably benign Het
Wdr7 G T 18: 63,958,192 (GRCm39) probably benign Het
Other mutations in Samd9l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Samd9l APN 6 3,376,779 (GRCm39) missense probably damaging 0.96
IGL00550:Samd9l APN 6 3,374,594 (GRCm39) missense probably benign 0.00
IGL01100:Samd9l APN 6 3,375,863 (GRCm39) missense possibly damaging 0.91
IGL01321:Samd9l APN 6 3,376,259 (GRCm39) missense probably benign 0.42
IGL01553:Samd9l APN 6 3,375,566 (GRCm39) missense probably damaging 0.99
IGL01575:Samd9l APN 6 3,376,734 (GRCm39) missense possibly damaging 0.85
IGL01896:Samd9l APN 6 3,375,120 (GRCm39) missense probably benign 0.02
IGL01915:Samd9l APN 6 3,373,864 (GRCm39) nonsense probably null
IGL02063:Samd9l APN 6 3,372,992 (GRCm39) missense probably damaging 1.00
IGL02066:Samd9l APN 6 3,376,575 (GRCm39) missense probably damaging 1.00
IGL02145:Samd9l APN 6 3,374,105 (GRCm39) missense probably benign 0.13
IGL02163:Samd9l APN 6 3,374,246 (GRCm39) missense possibly damaging 0.90
IGL02256:Samd9l APN 6 3,376,197 (GRCm39) missense probably damaging 1.00
IGL02508:Samd9l APN 6 3,374,798 (GRCm39) missense probably damaging 1.00
IGL02591:Samd9l APN 6 3,375,760 (GRCm39) missense possibly damaging 0.91
IGL02968:Samd9l APN 6 3,376,026 (GRCm39) missense probably damaging 1.00
IGL03058:Samd9l APN 6 3,374,980 (GRCm39) missense probably damaging 0.99
IGL03068:Samd9l APN 6 3,375,348 (GRCm39) nonsense probably null
IGL03160:Samd9l APN 6 3,374,894 (GRCm39) missense probably damaging 1.00
IGL03372:Samd9l APN 6 3,375,314 (GRCm39) missense probably damaging 1.00
IGL03385:Samd9l APN 6 3,376,208 (GRCm39) missense probably damaging 0.99
boston_lager UTSW 6 3,375,761 (GRCm39) missense probably benign 0.12
ipa UTSW 6 3,376,347 (GRCm39) missense probably damaging 1.00
Paine UTSW 6 3,372,716 (GRCm39) missense probably damaging 0.99
samad UTSW 6 3,374,032 (GRCm39) nonsense probably null
R0111:Samd9l UTSW 6 3,374,946 (GRCm39) missense possibly damaging 0.80
R0112:Samd9l UTSW 6 3,376,031 (GRCm39) missense possibly damaging 0.93
R0356:Samd9l UTSW 6 3,375,107 (GRCm39) missense possibly damaging 0.69
R0370:Samd9l UTSW 6 3,377,264 (GRCm39) start gained probably benign
R0398:Samd9l UTSW 6 3,374,502 (GRCm39) missense probably damaging 1.00
R0744:Samd9l UTSW 6 3,372,725 (GRCm39) missense possibly damaging 0.92
R0833:Samd9l UTSW 6 3,372,725 (GRCm39) missense possibly damaging 0.92
R0880:Samd9l UTSW 6 3,377,064 (GRCm39) missense probably damaging 0.99
R1110:Samd9l UTSW 6 3,374,267 (GRCm39) missense probably benign 0.44
R1155:Samd9l UTSW 6 3,376,939 (GRCm39) missense probably benign 0.01
R1268:Samd9l UTSW 6 3,376,113 (GRCm39) missense possibly damaging 0.56
R1293:Samd9l UTSW 6 3,373,947 (GRCm39) missense possibly damaging 0.93
R1478:Samd9l UTSW 6 3,376,369 (GRCm39) missense probably benign 0.06
R1573:Samd9l UTSW 6 3,375,426 (GRCm39) missense probably damaging 0.99
R1590:Samd9l UTSW 6 3,375,761 (GRCm39) missense probably benign 0.12
R1611:Samd9l UTSW 6 3,373,771 (GRCm39) missense probably benign 0.00
R1754:Samd9l UTSW 6 3,373,126 (GRCm39) missense probably damaging 0.96
R1759:Samd9l UTSW 6 3,373,401 (GRCm39) missense probably damaging 1.00
R1795:Samd9l UTSW 6 3,375,264 (GRCm39) nonsense probably null
R1829:Samd9l UTSW 6 3,375,107 (GRCm39) missense possibly damaging 0.69
R1935:Samd9l UTSW 6 3,376,269 (GRCm39) missense probably benign 0.01
R2154:Samd9l UTSW 6 3,372,945 (GRCm39) missense possibly damaging 0.91
R2228:Samd9l UTSW 6 3,376,910 (GRCm39) missense probably benign 0.08
R3622:Samd9l UTSW 6 3,374,032 (GRCm39) nonsense probably null
R3903:Samd9l UTSW 6 3,376,830 (GRCm39) nonsense probably null
R3904:Samd9l UTSW 6 3,376,830 (GRCm39) nonsense probably null
R3945:Samd9l UTSW 6 3,377,029 (GRCm39) missense possibly damaging 0.71
R4091:Samd9l UTSW 6 3,376,887 (GRCm39) missense probably benign 0.22
R4602:Samd9l UTSW 6 3,373,937 (GRCm39) frame shift probably null
R4602:Samd9l UTSW 6 3,373,935 (GRCm39) missense probably damaging 1.00
R4618:Samd9l UTSW 6 3,376,347 (GRCm39) missense probably damaging 1.00
R4747:Samd9l UTSW 6 3,375,504 (GRCm39) nonsense probably null
R4762:Samd9l UTSW 6 3,375,623 (GRCm39) missense probably benign 0.01
R4814:Samd9l UTSW 6 3,372,863 (GRCm39) missense probably damaging 0.98
R4934:Samd9l UTSW 6 3,375,621 (GRCm39) nonsense probably null
R5026:Samd9l UTSW 6 3,375,284 (GRCm39) missense possibly damaging 0.75
R5048:Samd9l UTSW 6 3,374,157 (GRCm39) missense probably benign 0.35
R5130:Samd9l UTSW 6 3,374,548 (GRCm39) missense possibly damaging 0.69
R5271:Samd9l UTSW 6 3,376,156 (GRCm39) missense probably benign 0.02
R5328:Samd9l UTSW 6 3,376,739 (GRCm39) missense probably damaging 0.99
R5507:Samd9l UTSW 6 3,373,898 (GRCm39) missense possibly damaging 0.78
R5587:Samd9l UTSW 6 3,373,291 (GRCm39) missense possibly damaging 0.84
R5846:Samd9l UTSW 6 3,376,754 (GRCm39) missense probably benign
R5881:Samd9l UTSW 6 3,372,716 (GRCm39) missense possibly damaging 0.70
R5889:Samd9l UTSW 6 3,376,460 (GRCm39) missense probably damaging 1.00
R6131:Samd9l UTSW 6 3,377,252 (GRCm39) missense probably benign 0.00
R6199:Samd9l UTSW 6 3,376,686 (GRCm39) missense probably benign 0.13
R6298:Samd9l UTSW 6 3,375,383 (GRCm39) missense probably damaging 1.00
R6331:Samd9l UTSW 6 3,376,361 (GRCm39) missense probably damaging 1.00
R6489:Samd9l UTSW 6 3,376,896 (GRCm39) missense probably benign
R6601:Samd9l UTSW 6 3,377,229 (GRCm39) missense possibly damaging 0.74
R6655:Samd9l UTSW 6 3,377,247 (GRCm39) missense probably benign 0.22
R6803:Samd9l UTSW 6 3,375,446 (GRCm39) missense probably damaging 0.97
R6864:Samd9l UTSW 6 3,374,750 (GRCm39) missense probably benign 0.14
R6905:Samd9l UTSW 6 3,375,387 (GRCm39) missense probably damaging 0.99
R6919:Samd9l UTSW 6 3,376,313 (GRCm39) missense possibly damaging 0.88
R7060:Samd9l UTSW 6 3,372,716 (GRCm39) missense probably damaging 0.99
R7073:Samd9l UTSW 6 3,375,856 (GRCm39) nonsense probably null
R7250:Samd9l UTSW 6 3,374,201 (GRCm39) missense possibly damaging 0.78
R7307:Samd9l UTSW 6 3,372,600 (GRCm39) nonsense probably null
R7351:Samd9l UTSW 6 3,374,157 (GRCm39) missense probably benign 0.35
R7423:Samd9l UTSW 6 3,374,408 (GRCm39) missense probably damaging 1.00
R7610:Samd9l UTSW 6 3,376,754 (GRCm39) missense probably benign
R7667:Samd9l UTSW 6 3,375,975 (GRCm39) missense possibly damaging 0.87
R7672:Samd9l UTSW 6 3,373,646 (GRCm39) missense probably benign 0.16
R7680:Samd9l UTSW 6 3,376,469 (GRCm39) missense probably damaging 1.00
R7680:Samd9l UTSW 6 3,372,569 (GRCm39) missense probably damaging 1.00
R7814:Samd9l UTSW 6 3,374,793 (GRCm39) missense possibly damaging 0.86
R7829:Samd9l UTSW 6 3,374,749 (GRCm39) missense probably benign 0.00
R8000:Samd9l UTSW 6 3,373,034 (GRCm39) missense probably damaging 1.00
R8098:Samd9l UTSW 6 3,375,549 (GRCm39) missense probably damaging 1.00
R8698:Samd9l UTSW 6 3,373,843 (GRCm39) missense probably benign 0.06
R8785:Samd9l UTSW 6 3,377,064 (GRCm39) missense probably damaging 0.99
R8795:Samd9l UTSW 6 3,374,221 (GRCm39) nonsense probably null
R8806:Samd9l UTSW 6 3,376,665 (GRCm39) missense probably damaging 0.99
R8832:Samd9l UTSW 6 3,374,990 (GRCm39) missense probably damaging 1.00
R8954:Samd9l UTSW 6 3,374,577 (GRCm39) missense probably damaging 0.98
R9023:Samd9l UTSW 6 3,373,791 (GRCm39) missense probably damaging 1.00
R9051:Samd9l UTSW 6 3,373,493 (GRCm39) missense probably benign 0.16
R9108:Samd9l UTSW 6 3,373,104 (GRCm39) missense possibly damaging 0.71
R9213:Samd9l UTSW 6 3,376,856 (GRCm39) missense probably benign 0.23
R9494:Samd9l UTSW 6 3,375,830 (GRCm39) missense possibly damaging 0.51
R9504:Samd9l UTSW 6 3,372,621 (GRCm39) missense probably benign 0.17
R9655:Samd9l UTSW 6 3,373,578 (GRCm39) missense probably benign 0.00
R9688:Samd9l UTSW 6 3,377,087 (GRCm39) missense probably damaging 1.00
R9696:Samd9l UTSW 6 3,375,078 (GRCm39) missense possibly damaging 0.76
R9721:Samd9l UTSW 6 3,375,854 (GRCm39) missense possibly damaging 0.69
X0026:Samd9l UTSW 6 3,375,560 (GRCm39) missense probably damaging 1.00
X0066:Samd9l UTSW 6 3,374,477 (GRCm39) missense probably damaging 1.00
Z1176:Samd9l UTSW 6 3,376,770 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTCATAGTGACTGGGCAG -3'
(R):5'- TTGTTTGTAAGAGAAGGAGCTAGC -3'

Sequencing Primer
(F):5'- CTCATAGTGACTGGGCAGGTGAAG -3'
(R):5'- GCTAGCTCTAAGAATATCCTGGGC -3'
Posted On 2017-01-24