Incidental Mutation 'R0553:Pdia2'
ID 45302
Institutional Source Beutler Lab
Gene Symbol Pdia2
Ensembl Gene ENSMUSG00000024184
Gene Name protein disulfide isomerase associated 2
Synonyms Pdipl, 1810041F13Rik, Pdip
MMRRC Submission 038745-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock # R0553 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 26195999-26199087 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 26196243 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 504 (E504G)
Ref Sequence ENSEMBL: ENSMUSP00000114080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025019] [ENSMUST00000039113] [ENSMUST00000074370] [ENSMUST00000118904] [ENSMUST00000120333] [ENSMUST00000121959] [ENSMUST00000163421] [ENSMUST00000176961]
AlphaFold D3Z6P0
Predicted Effect probably benign
Transcript: ENSMUST00000025019
SMART Domains Protein: ENSMUSP00000025019
Gene: ENSMUSG00000073433

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
Pfam:Rho_GDI 29 222 1.2e-60 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000039113
AA Change: E507G

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000035584
Gene: ENSMUSG00000024184
AA Change: E507G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Thioredoxin 46 153 1.5e-26 PFAM
Pfam:Thioredoxin_6 182 369 3.2e-37 PFAM
Pfam:Thioredoxin 392 497 2.4e-27 PFAM
low complexity region 501 515 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000074370
SMART Domains Protein: ENSMUSP00000073974
Gene: ENSMUSG00000024182

DomainStartEndE-ValueType
Pfam:AXIN1_TNKS_BD 13 85 7.5e-27 PFAM
RGS 93 216 3.03e-36 SMART
low complexity region 230 241 N/A INTRINSIC
low complexity region 330 344 N/A INTRINSIC
coiled coil region 394 432 N/A INTRINSIC
Pfam:Axin_b-cat_bind 468 523 3.2e-13 PFAM
low complexity region 533 544 N/A INTRINSIC
low complexity region 699 709 N/A INTRINSIC
low complexity region 713 727 N/A INTRINSIC
DAX 786 868 5.92e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118904
SMART Domains Protein: ENSMUSP00000113756
Gene: ENSMUSG00000024182

DomainStartEndE-ValueType
RGS 93 216 3.03e-36 SMART
low complexity region 230 241 N/A INTRINSIC
low complexity region 330 344 N/A INTRINSIC
coiled coil region 394 432 N/A INTRINSIC
Pfam:Axin_b-cat_bind 468 502 1.2e-18 PFAM
low complexity region 533 544 N/A INTRINSIC
low complexity region 699 709 N/A INTRINSIC
coiled coil region 712 734 N/A INTRINSIC
DAX 750 832 5.92e-45 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120333
AA Change: E504G

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114080
Gene: ENSMUSG00000024184
AA Change: E504G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Thioredoxin 46 153 2.6e-27 PFAM
Pfam:Thioredoxin_6 181 366 2e-37 PFAM
Pfam:Thioredoxin 389 494 7.2e-28 PFAM
low complexity region 498 512 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121959
SMART Domains Protein: ENSMUSP00000113186
Gene: ENSMUSG00000073433

DomainStartEndE-ValueType
Pfam:Rho_GDI 14 197 6.4e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142410
SMART Domains Protein: ENSMUSP00000115267
Gene: ENSMUSG00000024184

DomainStartEndE-ValueType
Pfam:Thioredoxin 38 145 3.8e-25 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000148134
AA Change: E133G
SMART Domains Protein: ENSMUSP00000116340
Gene: ENSMUSG00000024184
AA Change: E133G

DomainStartEndE-ValueType
Pfam:Thioredoxin 19 124 2e-28 PFAM
low complexity region 128 142 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155556
Predicted Effect probably benign
Transcript: ENSMUST00000163421
SMART Domains Protein: ENSMUSP00000132000
Gene: ENSMUSG00000024182

DomainStartEndE-ValueType
RGS 93 216 3.03e-36 SMART
low complexity region 230 241 N/A INTRINSIC
low complexity region 330 344 N/A INTRINSIC
coiled coil region 394 432 N/A INTRINSIC
Pfam:Axin_b-cat_bind 468 502 1.2e-18 PFAM
low complexity region 533 544 N/A INTRINSIC
low complexity region 699 709 N/A INTRINSIC
coiled coil region 712 734 N/A INTRINSIC
DAX 750 832 5.92e-45 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176847
Predicted Effect probably benign
Transcript: ENSMUST00000176961
SMART Domains Protein: ENSMUSP00000135717
Gene: ENSMUSG00000073433

DomainStartEndE-ValueType
Pfam:Rho_GDI 14 222 1.9e-83 PFAM
Meta Mutation Damage Score 0.0927 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze protein folding and thiol-disulfide interchange reactions. The encoded protein has an N-terminal ER-signal sequence, two catalytically active thioredoxin (TRX) domains, two TRX-like domains and a C-terminal ER-retention sequence. The protein plays a role in the folding of nascent proteins in the endoplasmic reticulum by forming disulfide bonds through its thiol isomerase, oxidase, and reductase activity. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,682,686 I729V probably damaging Het
9530002B09Rik A T 4: 122,702,335 M120L unknown Het
Adamts13 T A 2: 26,991,334 C774* probably null Het
Amh A G 10: 80,806,176 probably benign Het
Ccdc173 C A 2: 69,789,441 R8L probably damaging Het
Cd40 G A 2: 165,070,741 R204Q probably benign Het
Clhc1 A C 11: 29,561,366 probably benign Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Flg2 A T 3: 93,203,584 H973L unknown Het
Fut2 T A 7: 45,651,274 I25F probably damaging Het
Galnt7 T C 8: 57,552,430 probably benign Het
Gm438 T A 4: 144,777,415 I389L possibly damaging Het
Gm7534 T C 4: 134,202,518 T159A possibly damaging Het
Gm8909 G T 17: 36,168,057 P100Q probably damaging Het
Gmppb A T 9: 108,049,797 M56L probably benign Het
Grm3 C A 5: 9,570,048 A399S probably benign Het
Hey2 G A 10: 30,840,489 probably benign Het
Ift172 A G 5: 31,275,842 probably benign Het
Kcnh5 C A 12: 75,137,673 C92F probably benign Het
Kdm1a T C 4: 136,555,298 D229G probably damaging Het
Klf11 C G 12: 24,655,090 P164R probably benign Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Krtcap3 T C 5: 31,251,803 V6A probably benign Het
Ltbr A C 6: 125,313,388 probably null Het
Mmp17 T G 5: 129,598,670 S298A probably benign Het
Nacc2 T A 2: 26,089,590 E278V possibly damaging Het
Olfr175-ps1 A T 16: 58,824,155 Y185N probably damaging Het
Olfr875 T A 9: 37,773,331 I224N probably benign Het
Otop2 C T 11: 115,329,462 A376V probably damaging Het
Pdzph1 C T 17: 58,922,727 V979M probably damaging Het
Pou5f1 A G 17: 35,509,477 K86R possibly damaging Het
Ptprq A G 10: 107,710,627 F269L probably benign Het
Rb1 A T 14: 73,211,712 C659* probably null Het
Rnf8 T C 17: 29,621,639 probably null Het
Rras T G 7: 45,020,556 I137M probably benign Het
Slc38a9 A T 13: 112,714,198 H372L probably damaging Het
Spata9 T C 13: 75,977,779 probably null Het
Tas2r115 T C 6: 132,737,959 T10A probably benign Het
Ttn T C 2: 76,798,893 E12621G probably damaging Het
Unc80 A T 1: 66,506,669 I460F probably damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Zbtb24 C T 10: 41,451,997 A293V possibly damaging Het
Other mutations in Pdia2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Pdia2 APN 17 26198116 missense probably damaging 0.98
IGL01019:Pdia2 APN 17 26198922 missense probably damaging 1.00
IGL02289:Pdia2 APN 17 26197890 missense possibly damaging 0.66
IGL02725:Pdia2 APN 17 26196532 missense probably benign 0.05
Feline UTSW 17 26198868 missense probably benign 0.00
Hongry UTSW 17 26197660 missense possibly damaging 0.72
Ravenous UTSW 17 26196521 missense probably damaging 1.00
R0988:Pdia2 UTSW 17 26198829 missense probably damaging 1.00
R1624:Pdia2 UTSW 17 26196521 missense probably damaging 1.00
R1917:Pdia2 UTSW 17 26198105 missense possibly damaging 0.82
R3950:Pdia2 UTSW 17 26197616 critical splice donor site probably null
R4583:Pdia2 UTSW 17 26196502 missense probably damaging 1.00
R5455:Pdia2 UTSW 17 26197163 missense probably null 0.99
R6841:Pdia2 UTSW 17 26196604 splice site probably null
R6889:Pdia2 UTSW 17 26196970 nonsense probably null
R7312:Pdia2 UTSW 17 26197660 missense possibly damaging 0.72
R7743:Pdia2 UTSW 17 26198868 missense probably benign 0.00
R7897:Pdia2 UTSW 17 26198233 missense probably benign
R8518:Pdia2 UTSW 17 26198170 nonsense probably null
R9187:Pdia2 UTSW 17 26196936 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACAGTGTCCCAATGGCTACAGCTC -3'
(R):5'- TCCAGCTAGTCAAGCTGACTTCTCC -3'

Sequencing Primer
(F):5'- ACAGCTCCTCCTTGGGAC -3'
(R):5'- TTGGATGCTACAGCTAATGAGC -3'
Posted On 2013-06-11