Incidental Mutation 'IGL03054:Olfr617'
ID 453020
Institutional Source Beutler Lab
Gene Symbol Olfr617
Ensembl Gene ENSMUSG00000073946
Gene Name olfactory receptor 617
Synonyms GA_x6K02T2PBJ9-6306819-6307775, MOR31-10
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock # IGL03054 (G1)
Quality Score 148
Status Validated
Chromosome 7
Chromosomal Location 103573061-103586795 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 103584840 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Asparagine at position 273 (H273N)
Ref Sequence ENSEMBL: ENSMUSP00000149045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048265] [ENSMUST00000215755] [ENSMUST00000216516]
AlphaFold Q8VGA1
Predicted Effect probably benign
Transcript: ENSMUST00000048265
AA Change: H273N

PolyPhen 2 Score 0.235 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000040319
Gene: ENSMUSG00000073946
AA Change: H273N

DomainStartEndE-ValueType
Pfam:7tm_4 37 316 8.5e-109 PFAM
Pfam:7TM_GPCR_Srsx 41 225 2.3e-10 PFAM
Pfam:7tm_1 47 299 4.6e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179692
Predicted Effect probably benign
Transcript: ENSMUST00000215755
AA Change: H273N

PolyPhen 2 Score 0.235 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000216516
AA Change: H273N

PolyPhen 2 Score 0.235 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,886,528 T625A possibly damaging Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Aloxe3 T C 11: 69,129,607 V159A possibly damaging Het
Atp13a2 T A 4: 141,006,968 C1134S possibly damaging Het
Ccdc40 G A 11: 119,263,201 E1100K possibly damaging Het
Ceacam5 A T 7: 17,759,454 T801S possibly damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Col4a2 T C 8: 11,448,270 I1693T probably damaging Het
Crb1 CG C 1: 139,237,086 probably null Het
Dab2 G T 15: 6,418,226 probably benign Het
Dao T C 5: 114,024,902 L345P probably damaging Het
Dis3l A G 9: 64,310,440 probably null Het
Egr3 C T 14: 70,079,112 T124M probably damaging Het
Gng7 G T 10: 80,951,651 F59L probably damaging Het
Itgb4 C A 11: 116,000,340 Y1190* probably null Het
Lacc1 T C 14: 77,030,915 M319V possibly damaging Het
Mapkbp1 A G 2: 120,015,400 T417A probably damaging Het
Mier3 C T 13: 111,686,314 probably benign Het
Mlxipl A G 5: 135,133,256 D569G possibly damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mrpl15 A G 1: 4,785,571 probably null Het
Neb T C 2: 52,271,322 N2153D probably damaging Het
Nlrp9c A G 7: 26,382,276 probably null Het
Npepps C T 11: 97,241,788 probably benign Het
Olfr338 A T 2: 36,376,932 H52L possibly damaging Het
Olfr45 T G 7: 140,691,710 S268R probably benign Het
Psmc4 T C 7: 28,047,180 Y160C probably damaging Het
Rims1 T C 1: 22,290,109 Y131C probably damaging Het
Riok1 G A 13: 38,047,315 G183D probably damaging Het
Samd9l T A 6: 3,376,023 I413F probably damaging Het
Tnfrsf22 A G 7: 143,640,795 Y132H probably damaging Het
Ttn T A 2: 76,895,760 probably benign Het
Tulp1 A G 17: 28,359,313 probably benign Het
Usp15 C A 10: 123,125,931 probably benign Het
Wdr7 G T 18: 63,825,121 probably benign Het
Other mutations in Olfr617
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Olfr617 APN 7 103584693 missense probably damaging 1.00
IGL01355:Olfr617 APN 7 103584373 missense probably damaging 1.00
IGL01411:Olfr617 APN 7 103584117 missense probably damaging 1.00
IGL01412:Olfr617 APN 7 103584907 missense probably damaging 1.00
IGL02379:Olfr617 APN 7 103584892 missense possibly damaging 0.84
ANU23:Olfr617 UTSW 7 103584693 missense probably damaging 1.00
R0536:Olfr617 UTSW 7 103584261 missense probably damaging 1.00
R4222:Olfr617 UTSW 7 103584759 missense probably damaging 1.00
R4224:Olfr617 UTSW 7 103584759 missense probably damaging 1.00
R5342:Olfr617 UTSW 7 103584828 missense probably benign 0.05
R5587:Olfr617 UTSW 7 103584531 missense probably benign 0.07
R5607:Olfr617 UTSW 7 103584299 nonsense probably null
R5608:Olfr617 UTSW 7 103584299 nonsense probably null
R6904:Olfr617 UTSW 7 103584520 missense possibly damaging 0.83
R6929:Olfr617 UTSW 7 103584444 missense probably damaging 0.98
R7399:Olfr617 UTSW 7 103584381 missense possibly damaging 0.78
R7607:Olfr617 UTSW 7 103584930 missense probably damaging 0.97
R7771:Olfr617 UTSW 7 103584090 missense probably benign 0.33
Z1177:Olfr617 UTSW 7 103584699 missense probably benign 0.41
Z1177:Olfr617 UTSW 7 103584947 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAGATGCAGTGCTGATCATTGTC -3'
(R):5'- ATTGCCCTCAGAAATAATGACTTGC -3'

Sequencing Primer
(F):5'- GCAGTGCTGATCATTGTCTCATATGC -3'
(R):5'- CCTCAGAAATAATGACTTGCTTTAAC -3'
Posted On 2017-01-24