Incidental Mutation 'IGL03054:Mmp1a'
ID453025
Institutional Source Beutler Lab
Gene Symbol Mmp1a
Ensembl Gene ENSMUSG00000043089
Gene Namematrix metallopeptidase 1a (interstitial collagenase)
SynonymsMcol-A
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.353) question?
Stock #IGL03054 (G1)
Quality Score214
Status Validated
Chromosome9
Chromosomal Location7464141-7476869 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) TG to TGG at 7465083 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151193 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034492] [ENSMUST00000217651]
Predicted Effect probably null
Transcript: ENSMUST00000034492
SMART Domains Protein: ENSMUSP00000034492
Gene: ENSMUSG00000043089

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:PG_binding_1 25 84 8.2e-14 PFAM
ZnMc 97 259 2.99e-44 SMART
HX 281 323 8.12e-6 SMART
HX 325 369 7.81e-8 SMART
HX 374 421 5.82e-16 SMART
HX 423 463 2.18e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000217651
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme that degrades collagens. Mice lacking the encoded protein exhibit decreased susceptibility to chemical carcinogen-induced lung tumor development and angiogenesis. This gene is located in a cluster of other matrix metalloproteinase genes on chromosome 9. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced inflammatory response following chemical induction of tumors and male mice exhibit fewer large induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,886,528 T625A possibly damaging Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Aloxe3 T C 11: 69,129,607 V159A possibly damaging Het
Atp13a2 T A 4: 141,006,968 C1134S possibly damaging Het
Ccdc40 G A 11: 119,263,201 E1100K possibly damaging Het
Ceacam5 A T 7: 17,759,454 T801S possibly damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Col4a2 T C 8: 11,448,270 I1693T probably damaging Het
Crb1 CG C 1: 139,237,086 probably null Het
Dab2 G T 15: 6,418,226 probably benign Het
Dao T C 5: 114,024,902 L345P probably damaging Het
Dis3l A G 9: 64,310,440 probably null Het
Egr3 C T 14: 70,079,112 T124M probably damaging Het
Gng7 G T 10: 80,951,651 F59L probably damaging Het
Itgb4 C A 11: 116,000,340 Y1190* probably null Het
Lacc1 T C 14: 77,030,915 M319V possibly damaging Het
Mapkbp1 A G 2: 120,015,400 T417A probably damaging Het
Mier3 C T 13: 111,686,314 probably benign Het
Mlxipl A G 5: 135,133,256 D569G possibly damaging Het
Mrpl15 A G 1: 4,785,571 probably null Het
Neb T C 2: 52,271,322 N2153D probably damaging Het
Nlrp9c A G 7: 26,382,276 probably null Het
Npepps C T 11: 97,241,788 probably benign Het
Olfr338 A T 2: 36,376,932 H52L possibly damaging Het
Olfr45 T G 7: 140,691,710 S268R probably benign Het
Olfr617 C A 7: 103,584,840 H273N probably benign Het
Psmc4 T C 7: 28,047,180 Y160C probably damaging Het
Rims1 T C 1: 22,290,109 Y131C probably damaging Het
Riok1 G A 13: 38,047,315 G183D probably damaging Het
Samd9l T A 6: 3,376,023 I413F probably damaging Het
Tnfrsf22 A G 7: 143,640,795 Y132H probably damaging Het
Ttn T A 2: 76,895,760 probably benign Het
Tulp1 A G 17: 28,359,313 probably benign Het
Usp15 C A 10: 123,125,931 probably benign Het
Wdr7 G T 18: 63,825,121 probably benign Het
Other mutations in Mmp1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Mmp1a APN 9 7476259 missense probably benign 0.04
IGL02179:Mmp1a APN 9 7464273 missense probably benign 0.23
IGL02738:Mmp1a APN 9 7464301 splice site probably benign
IGL02984:Mmp1a UTSW 9 7465083 makesense probably null
IGL02988:Mmp1a UTSW 9 7465083 makesense probably null
IGL02991:Mmp1a UTSW 9 7465083 makesense probably null
IGL03014:Mmp1a UTSW 9 7465083 makesense probably null
IGL03050:Mmp1a UTSW 9 7465083 makesense probably null
IGL03055:Mmp1a UTSW 9 7465083 makesense probably null
IGL03097:Mmp1a UTSW 9 7465083 makesense probably null
IGL03098:Mmp1a UTSW 9 7465083 makesense probably null
IGL03134:Mmp1a UTSW 9 7465083 makesense probably null
IGL03138:Mmp1a UTSW 9 7465083 makesense probably null
IGL03147:Mmp1a UTSW 9 7465083 makesense probably null
R0095:Mmp1a UTSW 9 7465620 missense possibly damaging 0.51
R0095:Mmp1a UTSW 9 7465620 missense possibly damaging 0.51
R1422:Mmp1a UTSW 9 7464298 splice site probably null
R1663:Mmp1a UTSW 9 7465656 missense probably benign 0.33
R1801:Mmp1a UTSW 9 7475390 missense probably damaging 1.00
R2171:Mmp1a UTSW 9 7475356 missense probably damaging 0.99
R3415:Mmp1a UTSW 9 7464869 missense possibly damaging 0.92
R3901:Mmp1a UTSW 9 7475345 makesense probably null
R4175:Mmp1a UTSW 9 7467235 missense probably benign 0.03
R5406:Mmp1a UTSW 9 7467293 missense probably damaging 1.00
R6462:Mmp1a UTSW 9 7467038 missense probably benign 0.01
R7016:Mmp1a UTSW 9 7465083 makesense probably null
R7039:Mmp1a UTSW 9 7465083 makesense probably null
R7098:Mmp1a UTSW 9 7475937 missense probably benign 0.00
R7144:Mmp1a UTSW 9 7475318 missense probably damaging 1.00
R7196:Mmp1a UTSW 9 7476017 nonsense probably null
R7284:Mmp1a UTSW 9 7465083 makesense probably null
R7289:Mmp1a UTSW 9 7467293 missense probably damaging 1.00
R7313:Mmp1a UTSW 9 7465083 makesense probably null
R7510:Mmp1a UTSW 9 7465083 makesense probably null
R7537:Mmp1a UTSW 9 7465083 makesense probably null
R7574:Mmp1a UTSW 9 7465083 makesense probably null
R7626:Mmp1a UTSW 9 7465083 makesense probably null
R7755:Mmp1a UTSW 9 7467004 missense possibly damaging 0.92
R7789:Mmp1a UTSW 9 7475265 missense possibly damaging 0.70
R7791:Mmp1a UTSW 9 7465083 makesense probably null
R7900:Mmp1a UTSW 9 7465083 makesense probably null
R8000:Mmp1a UTSW 9 7476214 missense probably benign 0.11
R8009:Mmp1a UTSW 9 7467235 missense possibly damaging 0.76
R8039:Mmp1a UTSW 9 7465083 makesense probably null
R8072:Mmp1a UTSW 9 7465083 makesense probably null
RF004:Mmp1a UTSW 9 7465083 makesense probably null
X0020:Mmp1a UTSW 9 7465626 missense probably damaging 1.00
Z1177:Mmp1a UTSW 9 7464230 missense probably benign 0.21
Z1177:Mmp1a UTSW 9 7467033 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- CTGGAAAACTACTACAACTTGGGC -3'
(R):5'- CTCCAGACTCTAAAGGCTCTCG -3'

Sequencing Primer
(F):5'- TACTACAACTTGGGCAAAAACATG -3'
(R):5'- AGACTCTAAAGGCTCTCGCGATG -3'
Posted On2017-01-24