Incidental Mutation 'R0553:Rnf8'
ID 45303
Institutional Source Beutler Lab
Gene Symbol Rnf8
Ensembl Gene ENSMUSG00000090083
Gene Name ring finger protein 8
Synonyms AIP37, 3830404E21Rik
MMRRC Submission 038745-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock # R0553 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 29614790-29641664 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 29621639 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024817] [ENSMUST00000024817] [ENSMUST00000130871] [ENSMUST00000162588] [ENSMUST00000172485] [ENSMUST00000173449] [ENSMUST00000173449]
AlphaFold Q8VC56
Predicted Effect probably null
Transcript: ENSMUST00000024817
SMART Domains Protein: ENSMUSP00000024817
Gene: ENSMUSG00000090083

DomainStartEndE-ValueType
FHA 37 92 5.55e-8 SMART
low complexity region 116 130 N/A INTRINSIC
low complexity region 299 317 N/A INTRINSIC
RING 406 443 3.64e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000024817
SMART Domains Protein: ENSMUSP00000024817
Gene: ENSMUSG00000090083

DomainStartEndE-ValueType
FHA 37 92 5.55e-8 SMART
low complexity region 116 130 N/A INTRINSIC
low complexity region 299 317 N/A INTRINSIC
RING 406 443 3.64e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130871
SMART Domains Protein: ENSMUSP00000117838
Gene: ENSMUSG00000098374

DomainStartEndE-ValueType
FHA 37 92 5.55e-8 SMART
low complexity region 116 130 N/A INTRINSIC
low complexity region 299 317 N/A INTRINSIC
RING 406 443 3.64e-7 SMART
G_patch 524 570 1.93e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150388
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161952
Predicted Effect probably benign
Transcript: ENSMUST00000162588
SMART Domains Protein: ENSMUSP00000124566
Gene: ENSMUSG00000090083

DomainStartEndE-ValueType
PDB:2PIE|A 11 103 2e-21 PDB
SCOP:d1g6ga_ 38 85 1e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172485
SMART Domains Protein: ENSMUSP00000134697
Gene: ENSMUSG00000090083

DomainStartEndE-ValueType
Pfam:FHA 38 86 1.2e-6 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000173449
SMART Domains Protein: ENSMUSP00000133424
Gene: ENSMUSG00000090083

DomainStartEndE-ValueType
Pfam:FHA 1 52 2.5e-13 PFAM
low complexity region 59 73 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000173449
SMART Domains Protein: ENSMUSP00000133424
Gene: ENSMUSG00000090083

DomainStartEndE-ValueType
Pfam:FHA 1 52 2.5e-13 PFAM
low complexity region 59 73 N/A INTRINSIC
Meta Mutation Damage Score 0.9503 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING finger motif and an FHA domain. This protein has been shown to interact with several class II ubiquitin-conjugating enzymes (E2), including UBE2E1/UBCH6, UBE2E2, and UBE2E3, and may act as an ubiquitin ligase (E3) in the ubiquitination of certain nuclear proteins. This protein is also known to play a role in the DNA damage response and depletion of this protein causes cell growth inhibition and cell cycle arrest. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous null mice are runted and display premature death, immune organ hypocellularity, reduced male fertility, impaired spermatogenesis, increased sensitivity to gamma-irradiation, increased chromosome breakage and tumor incidence, and a gene dose-dependent defect in class switch recombination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,682,686 I729V probably damaging Het
9530002B09Rik A T 4: 122,702,335 M120L unknown Het
Adamts13 T A 2: 26,991,334 C774* probably null Het
Amh A G 10: 80,806,176 probably benign Het
Ccdc173 C A 2: 69,789,441 R8L probably damaging Het
Cd40 G A 2: 165,070,741 R204Q probably benign Het
Clhc1 A C 11: 29,561,366 probably benign Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Flg2 A T 3: 93,203,584 H973L unknown Het
Fut2 T A 7: 45,651,274 I25F probably damaging Het
Galnt7 T C 8: 57,552,430 probably benign Het
Gm438 T A 4: 144,777,415 I389L possibly damaging Het
Gm7534 T C 4: 134,202,518 T159A possibly damaging Het
Gm8909 G T 17: 36,168,057 P100Q probably damaging Het
Gmppb A T 9: 108,049,797 M56L probably benign Het
Grm3 C A 5: 9,570,048 A399S probably benign Het
Hey2 G A 10: 30,840,489 probably benign Het
Ift172 A G 5: 31,275,842 probably benign Het
Kcnh5 C A 12: 75,137,673 C92F probably benign Het
Kdm1a T C 4: 136,555,298 D229G probably damaging Het
Klf11 C G 12: 24,655,090 P164R probably benign Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Krtcap3 T C 5: 31,251,803 V6A probably benign Het
Ltbr A C 6: 125,313,388 probably null Het
Mmp17 T G 5: 129,598,670 S298A probably benign Het
Nacc2 T A 2: 26,089,590 E278V possibly damaging Het
Olfr175-ps1 A T 16: 58,824,155 Y185N probably damaging Het
Olfr875 T A 9: 37,773,331 I224N probably benign Het
Otop2 C T 11: 115,329,462 A376V probably damaging Het
Pdia2 T C 17: 26,196,243 E504G probably damaging Het
Pdzph1 C T 17: 58,922,727 V979M probably damaging Het
Pou5f1 A G 17: 35,509,477 K86R possibly damaging Het
Ptprq A G 10: 107,710,627 F269L probably benign Het
Rb1 A T 14: 73,211,712 C659* probably null Het
Rras T G 7: 45,020,556 I137M probably benign Het
Slc38a9 A T 13: 112,714,198 H372L probably damaging Het
Spata9 T C 13: 75,977,779 probably null Het
Tas2r115 T C 6: 132,737,959 T10A probably benign Het
Ttn T C 2: 76,798,893 E12621G probably damaging Het
Unc80 A T 1: 66,506,669 I460F probably damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Zbtb24 C T 10: 41,451,997 A293V possibly damaging Het
Other mutations in Rnf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1523:Rnf8 UTSW 17 29626972 missense probably damaging 0.99
R1713:Rnf8 UTSW 17 29634761 missense probably damaging 1.00
R1893:Rnf8 UTSW 17 29621550 missense probably damaging 0.98
R4194:Rnf8 UTSW 17 29631668 unclassified probably benign
R4985:Rnf8 UTSW 17 29626860 missense possibly damaging 0.85
R5155:Rnf8 UTSW 17 29626630 missense probably damaging 1.00
R5279:Rnf8 UTSW 17 29626706 missense possibly damaging 0.88
R6789:Rnf8 UTSW 17 29635869 missense probably damaging 1.00
R7623:Rnf8 UTSW 17 29629006 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTGCAAAGAACCTCCCCTGTTAG -3'
(R):5'- GTGTCCTACCAAACCAGTGACTGTAAG -3'

Sequencing Primer
(F):5'- GCATAGTGACGGATTGTGTCTTAAC -3'
(R):5'- tctcccaactgcctgaaac -3'
Posted On 2013-06-11