Incidental Mutation 'R0553:Pou5f1'
ID 45304
Institutional Source Beutler Lab
Gene Symbol Pou5f1
Ensembl Gene ENSMUSG00000024406
Gene Name POU domain, class 5, transcription factor 1
Synonyms Otf-3, Oct-4, Oct3/4, Otf3, Otf4, Oct4, Oct-3/4, Otf3g, Oct-3, Otf3-rs7, Otf-4
MMRRC Submission 038745-MU
Accession Numbers

VEGA: OTTMUST00000096009; MGI: 101893

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0553 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 35506018-35510772 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 35509477 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 86 (K86R)
Ref Sequence ENSEMBL: ENSMUSP00000134493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025271] [ENSMUST00000160885] [ENSMUST00000161012] [ENSMUST00000172651] [ENSMUST00000173256] [ENSMUST00000173805] [ENSMUST00000173934] [ENSMUST00000174782]
AlphaFold P20263
Predicted Effect possibly damaging
Transcript: ENSMUST00000025271
AA Change: K192R

PolyPhen 2 Score 0.603 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000025271
Gene: ENSMUSG00000024406
AA Change: K192R

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 39 49 N/A INTRINSIC
low complexity region 72 85 N/A INTRINSIC
POU 131 205 2.88e-47 SMART
HOX 223 285 4.75e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160885
SMART Domains Protein: ENSMUSP00000125167
Gene: ENSMUSG00000050410

DomainStartEndE-ValueType
low complexity region 11 16 N/A INTRINSIC
FHA 30 88 8.28e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161012
SMART Domains Protein: ENSMUSP00000125310
Gene: ENSMUSG00000050410

DomainStartEndE-ValueType
low complexity region 11 16 N/A INTRINSIC
FHA 30 88 8.28e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000172651
AA Change: K61R

PolyPhen 2 Score 0.603 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000134654
Gene: ENSMUSG00000024406
AA Change: K61R

DomainStartEndE-ValueType
POU 1 74 1.3e-45 SMART
Pfam:Homeobox 93 132 1.2e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000173256
AA Change: K61R

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000134060
Gene: ENSMUSG00000024406
AA Change: K61R

DomainStartEndE-ValueType
POU 1 74 1.3e-45 SMART
Pfam:Homeobox 93 132 1.2e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000173805
AA Change: K61R

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000133633
Gene: ENSMUSG00000024406
AA Change: K61R

DomainStartEndE-ValueType
POU 1 74 1.3e-45 SMART
Pfam:Homeobox 93 132 1.2e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000173934
AA Change: K61R

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000134729
Gene: ENSMUSG00000024406
AA Change: K61R

DomainStartEndE-ValueType
POU 1 74 1.3e-45 SMART
Pfam:Homeobox 93 132 1.2e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000174782
AA Change: K86R

PolyPhen 2 Score 0.761 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000134493
Gene: ENSMUSG00000024406
AA Change: K86R

DomainStartEndE-ValueType
POU 25 99 2.88e-47 SMART
Pfam:Homeobox 118 157 1.1e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175723
Meta Mutation Damage Score 0.5173 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the POU domain family of transcription factors. POU domain transcription factors bind to a specific octamer DNA motif and regulate cell type-specific differentiation pathways. The encoded protein plays a key role in embryonic development and stem cell pluripotency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygosity for a targeted null mutation results in peri-implantation lethality prior to the egg cylinder stage, associated with failure to develop a pluripotent inner cell mass. Conditional mutations show defects in reproduction. [provided by MGI curators]
Allele List at MGI

All alleles(86) : Targeted(7) Gene trapped(79)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,682,686 I729V probably damaging Het
9530002B09Rik A T 4: 122,702,335 M120L unknown Het
Adamts13 T A 2: 26,991,334 C774* probably null Het
Amh A G 10: 80,806,176 probably benign Het
Ccdc173 C A 2: 69,789,441 R8L probably damaging Het
Cd40 G A 2: 165,070,741 R204Q probably benign Het
Clhc1 A C 11: 29,561,366 probably benign Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Flg2 A T 3: 93,203,584 H973L unknown Het
Fut2 T A 7: 45,651,274 I25F probably damaging Het
Galnt7 T C 8: 57,552,430 probably benign Het
Gm438 T A 4: 144,777,415 I389L possibly damaging Het
Gm7534 T C 4: 134,202,518 T159A possibly damaging Het
Gm8909 G T 17: 36,168,057 P100Q probably damaging Het
Gmppb A T 9: 108,049,797 M56L probably benign Het
Grm3 C A 5: 9,570,048 A399S probably benign Het
Hey2 G A 10: 30,840,489 probably benign Het
Ift172 A G 5: 31,275,842 probably benign Het
Kcnh5 C A 12: 75,137,673 C92F probably benign Het
Kdm1a T C 4: 136,555,298 D229G probably damaging Het
Klf11 C G 12: 24,655,090 P164R probably benign Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Krtcap3 T C 5: 31,251,803 V6A probably benign Het
Ltbr A C 6: 125,313,388 probably null Het
Mmp17 T G 5: 129,598,670 S298A probably benign Het
Nacc2 T A 2: 26,089,590 E278V possibly damaging Het
Olfr175-ps1 A T 16: 58,824,155 Y185N probably damaging Het
Olfr875 T A 9: 37,773,331 I224N probably benign Het
Otop2 C T 11: 115,329,462 A376V probably damaging Het
Pdia2 T C 17: 26,196,243 E504G probably damaging Het
Pdzph1 C T 17: 58,922,727 V979M probably damaging Het
Ptprq A G 10: 107,710,627 F269L probably benign Het
Rb1 A T 14: 73,211,712 C659* probably null Het
Rnf8 T C 17: 29,621,639 probably null Het
Rras T G 7: 45,020,556 I137M probably benign Het
Slc38a9 A T 13: 112,714,198 H372L probably damaging Het
Spata9 T C 13: 75,977,779 probably null Het
Tas2r115 T C 6: 132,737,959 T10A probably benign Het
Ttn T C 2: 76,798,893 E12621G probably damaging Het
Unc80 A T 1: 66,506,669 I460F probably damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Zbtb24 C T 10: 41,451,997 A293V possibly damaging Het
Other mutations in Pou5f1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02744:Pou5f1 APN 17 35509414 missense probably damaging 1.00
IGL03062:Pou5f1 APN 17 35510039 missense possibly damaging 0.86
IGL03091:Pou5f1 APN 17 35510042 missense probably benign 0.32
R2105:Pou5f1 UTSW 17 35510002 missense probably benign 0.01
R2231:Pou5f1 UTSW 17 35510062 missense probably benign
R4691:Pou5f1 UTSW 17 35506131 missense probably damaging 0.98
R4953:Pou5f1 UTSW 17 35510541 missense possibly damaging 0.54
R6208:Pou5f1 UTSW 17 35510460 missense possibly damaging 0.50
R8171:Pou5f1 UTSW 17 35510036 missense probably benign 0.26
R8914:Pou5f1 UTSW 17 35510474 missense probably benign 0.00
R8957:Pou5f1 UTSW 17 35510469 missense possibly damaging 0.86
R9122:Pou5f1 UTSW 17 35509056 missense probably benign 0.00
X0027:Pou5f1 UTSW 17 35506446 missense probably benign
Predicted Primers PCR Primer
(F):5'- GATCTCACGGCTCTTAATGTAGGCG -3'
(R):5'- TCTGAGCCTTCACCAGCACTAGAC -3'

Sequencing Primer
(F):5'- AGCTGCTTCTCCACAGGTAAG -3'
(R):5'- GCAAATGTTAAGGCTCTGGATTCC -3'
Posted On 2013-06-11