Incidental Mutation 'R5106:Nedd4l'
ID 453046
Institutional Source Beutler Lab
Gene Symbol Nedd4l
Ensembl Gene ENSMUSG00000024589
Gene Name neural precursor cell expressed, developmentally down-regulated gene 4-like
Synonyms Nedd4-2, Nedd4b, 1300012C07Rik
MMRRC Submission 042694-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.196) question?
Stock # R5106 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 65020776-65350899 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 65326376 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 568 (T568M)
Ref Sequence ENSEMBL: ENSMUSP00000153526 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080418] [ENSMUST00000163516] [ENSMUST00000224347] [ENSMUST00000226058]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000080418
AA Change: T568M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079280
Gene: ENSMUSG00000024589
AA Change: T568M

DomainStartEndE-ValueType
PDB:3M7F|B 1 64 2e-21 PDB
WW 73 105 2.32e-13 SMART
low complexity region 139 154 N/A INTRINSIC
low complexity region 166 178 N/A INTRINSIC
low complexity region 234 247 N/A INTRINSIC
WW 266 298 2.08e-15 SMART
low complexity region 355 371 N/A INTRINSIC
WW 378 410 4.1e-14 SMART
WW 429 461 1.53e-13 SMART
HECTc 518 854 3.04e-183 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163516
AA Change: T689M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132838
Gene: ENSMUSG00000024589
AA Change: T689M

DomainStartEndE-ValueType
C2 21 124 1.76e-25 SMART
WW 194 226 2.32e-13 SMART
low complexity region 260 275 N/A INTRINSIC
low complexity region 287 299 N/A INTRINSIC
low complexity region 355 368 N/A INTRINSIC
WW 387 419 2.08e-15 SMART
low complexity region 476 492 N/A INTRINSIC
WW 499 531 4.1e-14 SMART
WW 550 582 1.53e-13 SMART
HECTc 639 975 3.04e-183 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000224347
AA Change: T548M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224663
Predicted Effect probably damaging
Transcript: ENSMUST00000226058
AA Change: T568M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.1335 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.0%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Nedd4 family of HECT domain E3 ubiquitin ligases. HECT domain E3 ubiquitin ligases transfer ubiquitin from E2 ubiquitin-conjugating enzymes to protein substrates, thus targeting specific proteins for lysosomal degradation. The encoded protein mediates the ubiquitination of multiple target substrates and plays a critical role in epithelial sodium transport by regulating the cell surface expression of the epithelial sodium channel, ENaC. Single nucleotide polymorphisms in this gene may be associated with essential hypertension. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a null mutation display salt sensitive hypertension and high salt diet induced cardiac hypertrophy. A spontaneous mutation results in overt diabetes insipidus. Mice homozygous for a knock-out allele exhibit neonatal lethality with primary atelectasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
C1qtnf2 G A 11: 43,376,880 (GRCm39) R84Q possibly damaging Het
Carmil2 T A 8: 106,420,638 (GRCm39) probably null Het
Cenpf A T 1: 189,416,005 (GRCm39) C107S probably benign Het
Cideb T C 14: 55,991,982 (GRCm39) M191V probably benign Het
Cope C A 8: 70,763,097 (GRCm39) R213S possibly damaging Het
Ctcf T C 8: 106,408,130 (GRCm39) probably benign Het
Daam2 T C 17: 49,783,489 (GRCm39) Y647C probably damaging Het
Dlg2 T C 7: 92,091,894 (GRCm39) Y920H probably damaging Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Het
Fdps C A 3: 89,006,710 (GRCm39) R127L probably damaging Het
G6pd2 C T 5: 61,967,695 (GRCm39) T490I probably benign Het
Gm6401 A G 14: 41,787,463 (GRCm39) M121T probably damaging Het
Gnl2 T C 4: 124,947,329 (GRCm39) probably null Het
Gprc5c G T 11: 114,755,093 (GRCm39) V257L possibly damaging Het
Gtf2a1l A G 17: 89,002,073 (GRCm39) S310G possibly damaging Het
Igdcc4 T C 9: 65,031,983 (GRCm39) F500L probably damaging Het
Lgr4 A T 2: 109,827,940 (GRCm39) H207L probably damaging Het
Llcfc1 A G 6: 41,662,310 (GRCm39) M105V probably benign Het
Macroh2a1 A G 13: 56,236,106 (GRCm39) V213A possibly damaging Het
Map2k3 A G 11: 60,832,708 (GRCm39) K18E probably damaging Het
Mccc1 T A 3: 36,026,713 (GRCm39) D528V probably benign Het
Nr3c1 A C 18: 39,619,654 (GRCm39) I211S possibly damaging Het
Nudt5 C T 2: 5,859,640 (GRCm39) probably benign Het
Or2ag20 T A 7: 106,464,595 (GRCm39) M136K probably damaging Het
Or5d46 T C 2: 88,170,454 (GRCm39) Y182H probably benign Het
Or6c202 T C 10: 128,996,106 (GRCm39) Y249C probably damaging Het
Or9k2b A T 10: 130,016,177 (GRCm39) S191T probably benign Het
Pcid2 A T 8: 13,129,648 (GRCm39) F326I probably damaging Het
Pcnt A T 10: 76,237,278 (GRCm39) I1336N probably damaging Het
Pomk T C 8: 26,476,404 (GRCm39) D50G probably benign Het
Ppp2r2a T C 14: 67,260,546 (GRCm39) Y244C probably damaging Het
Ptprz1 A G 6: 23,000,027 (GRCm39) T706A probably benign Het
Rad54l G A 4: 115,956,961 (GRCm39) probably benign Het
Raph1 T C 1: 60,572,459 (GRCm39) D36G probably damaging Het
Rgs7 A G 1: 174,904,416 (GRCm39) S166P possibly damaging Het
Rnf183 C G 4: 62,346,465 (GRCm39) R111P probably damaging Het
Rp1l1 A T 14: 64,265,395 (GRCm39) D327V probably damaging Het
Rpl3l A G 17: 24,951,411 (GRCm39) Y156C probably damaging Het
Slc25a54 G T 3: 109,020,180 (GRCm39) C398F probably benign Het
Slc39a2 A G 14: 52,132,988 (GRCm39) *310W probably null Het
Slit3 T C 11: 35,503,194 (GRCm39) C464R probably damaging Het
Smu1 A T 4: 40,743,104 (GRCm39) F345I possibly damaging Het
Ssc5d T A 7: 4,939,664 (GRCm39) V700E probably benign Het
Stxbp3 T C 3: 108,702,243 (GRCm39) Y521C probably benign Het
Tenm4 T C 7: 96,492,356 (GRCm39) S1061P probably damaging Het
Thoc5 T C 11: 4,860,630 (GRCm39) S103P probably damaging Het
Tmem221 A G 8: 72,008,522 (GRCm39) F173L probably benign Het
Trit1 T C 4: 122,948,106 (GRCm39) probably benign Het
Ttc23l G T 15: 10,551,636 (GRCm39) T30K possibly damaging Het
Vmn2r106 T C 17: 20,499,395 (GRCm39) probably null Het
Vmn2r38 C A 7: 9,078,169 (GRCm39) V738L possibly damaging Het
Zfp160 T A 17: 21,247,023 (GRCm39) H524Q probably damaging Het
Zfp791 T A 8: 85,837,259 (GRCm39) K202* probably null Het
Zfp985 T A 4: 147,668,612 (GRCm39) S493R probably damaging Het
Zkscan7 T C 9: 122,725,198 (GRCm39) probably benign Het
Zwilch A C 9: 64,060,866 (GRCm39) F329V probably damaging Het
Other mutations in Nedd4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Nedd4l APN 18 65,341,163 (GRCm39) missense probably damaging 1.00
IGL00931:Nedd4l APN 18 65,305,470 (GRCm39) missense possibly damaging 0.57
IGL02306:Nedd4l APN 18 65,306,025 (GRCm39) missense possibly damaging 0.64
IGL02363:Nedd4l APN 18 65,341,116 (GRCm39) splice site probably benign
IGL02440:Nedd4l APN 18 65,296,244 (GRCm39) critical splice donor site probably null
IGL02444:Nedd4l APN 18 65,337,028 (GRCm39) splice site probably benign
IGL02700:Nedd4l APN 18 65,342,751 (GRCm39) missense probably damaging 1.00
IGL02943:Nedd4l APN 18 65,294,723 (GRCm39) critical splice donor site probably null
IGL02999:Nedd4l APN 18 65,331,778 (GRCm39) missense probably damaging 1.00
IGL03135:Nedd4l APN 18 65,338,741 (GRCm39) missense probably damaging 1.00
IGL03373:Nedd4l APN 18 65,314,391 (GRCm39) splice site probably benign
R0036:Nedd4l UTSW 18 65,184,194 (GRCm39) intron probably benign
R0396:Nedd4l UTSW 18 65,294,725 (GRCm39) splice site probably benign
R0472:Nedd4l UTSW 18 65,341,532 (GRCm39) missense probably damaging 1.00
R0494:Nedd4l UTSW 18 65,306,092 (GRCm39) missense possibly damaging 0.69
R0513:Nedd4l UTSW 18 65,328,256 (GRCm39) splice site probably benign
R0609:Nedd4l UTSW 18 65,341,532 (GRCm39) missense probably damaging 1.00
R0631:Nedd4l UTSW 18 65,341,574 (GRCm39) splice site probably benign
R1077:Nedd4l UTSW 18 65,300,570 (GRCm39) splice site probably benign
R1643:Nedd4l UTSW 18 65,331,712 (GRCm39) missense probably damaging 1.00
R1722:Nedd4l UTSW 18 65,291,010 (GRCm39) missense probably damaging 1.00
R1806:Nedd4l UTSW 18 65,345,862 (GRCm39) missense probably damaging 1.00
R1921:Nedd4l UTSW 18 65,300,646 (GRCm39) critical splice donor site probably null
R1986:Nedd4l UTSW 18 65,276,874 (GRCm39) missense probably damaging 1.00
R2070:Nedd4l UTSW 18 65,345,891 (GRCm39) missense probably damaging 1.00
R2151:Nedd4l UTSW 18 65,343,401 (GRCm39) missense probably damaging 1.00
R2152:Nedd4l UTSW 18 65,343,401 (GRCm39) missense probably damaging 1.00
R2154:Nedd4l UTSW 18 65,343,401 (GRCm39) missense probably damaging 1.00
R2358:Nedd4l UTSW 18 65,342,790 (GRCm39) missense possibly damaging 0.51
R2680:Nedd4l UTSW 18 65,296,201 (GRCm39) missense possibly damaging 0.85
R3082:Nedd4l UTSW 18 65,312,049 (GRCm39) missense probably benign 0.00
R3500:Nedd4l UTSW 18 65,345,931 (GRCm39) missense probably damaging 1.00
R3711:Nedd4l UTSW 18 65,342,790 (GRCm39) missense possibly damaging 0.51
R3712:Nedd4l UTSW 18 65,342,790 (GRCm39) missense possibly damaging 0.51
R3874:Nedd4l UTSW 18 65,300,606 (GRCm39) missense probably benign
R4435:Nedd4l UTSW 18 65,345,896 (GRCm39) missense possibly damaging 0.84
R4698:Nedd4l UTSW 18 65,336,951 (GRCm39) missense probably damaging 1.00
R4757:Nedd4l UTSW 18 65,298,676 (GRCm39) missense probably damaging 0.98
R4783:Nedd4l UTSW 18 65,305,998 (GRCm39) missense probably damaging 0.99
R4790:Nedd4l UTSW 18 65,337,016 (GRCm39) missense possibly damaging 0.94
R4980:Nedd4l UTSW 18 65,213,131 (GRCm39) nonsense probably null
R5122:Nedd4l UTSW 18 65,324,518 (GRCm39) missense probably damaging 1.00
R5605:Nedd4l UTSW 18 65,307,315 (GRCm39) critical splice donor site probably null
R6465:Nedd4l UTSW 18 65,288,335 (GRCm39) missense probably benign 0.06
R6479:Nedd4l UTSW 18 65,342,752 (GRCm39) missense probably damaging 1.00
R6622:Nedd4l UTSW 18 65,307,305 (GRCm39) missense probably damaging 0.99
R6773:Nedd4l UTSW 18 65,300,622 (GRCm39) missense probably benign 0.36
R7065:Nedd4l UTSW 18 65,329,040 (GRCm39) missense probably benign 0.04
R7068:Nedd4l UTSW 18 65,338,722 (GRCm39) missense probably damaging 1.00
R7193:Nedd4l UTSW 18 65,130,441 (GRCm39) missense probably damaging 1.00
R7496:Nedd4l UTSW 18 65,213,089 (GRCm39) missense possibly damaging 0.94
R7903:Nedd4l UTSW 18 65,319,438 (GRCm39) missense probably damaging 1.00
R8123:Nedd4l UTSW 18 65,207,845 (GRCm39) missense probably damaging 1.00
R8185:Nedd4l UTSW 18 65,342,769 (GRCm39) missense probably damaging 1.00
R8282:Nedd4l UTSW 18 65,324,560 (GRCm39) missense probably damaging 0.98
R8440:Nedd4l UTSW 18 65,022,126 (GRCm39) splice site probably null
R8499:Nedd4l UTSW 18 65,342,728 (GRCm39) missense probably damaging 0.98
R8557:Nedd4l UTSW 18 65,336,986 (GRCm39) missense probably benign 0.00
R8801:Nedd4l UTSW 18 65,288,346 (GRCm39) missense probably damaging 1.00
R8896:Nedd4l UTSW 18 65,298,688 (GRCm39) missense probably benign
R9025:Nedd4l UTSW 18 65,311,995 (GRCm39) missense probably damaging 0.98
R9040:Nedd4l UTSW 18 65,342,734 (GRCm39) missense probably damaging 0.99
R9482:Nedd4l UTSW 18 65,021,031 (GRCm39) unclassified probably benign
R9498:Nedd4l UTSW 18 65,294,723 (GRCm39) critical splice donor site probably null
R9599:Nedd4l UTSW 18 65,343,400 (GRCm39) missense probably damaging 1.00
RF013:Nedd4l UTSW 18 65,342,751 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTGATATTCCAAACAGGTTTG -3'
(R):5'- GCCATGTTGGATCAGAACTTG -3'

Sequencing Primer
(F):5'- ACATATTTGAAGAGTCCTATCGGAG -3'
(R):5'- TGTTGGATCAGAACTTGTTTTTAGAC -3'
Posted On 2017-01-25