Mutagenetix > Incidental Mutation

Incidental Mutation 'R5106:Nedd4l'

453046

Institutional Source

Beutler Lab

Gene Symbol

Nedd4l

Ensembl Gene

ENSMUSG00000024589

Gene Name

neural precursor cell expressed, developmentally down-regulated gene 4-like

Synonyms

Nedd4-2, Nedd4b, 1300012C07Rik

MMRRC Submission

042694-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.201) question?

Stock #

R5106 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

64887705-65217831 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 65193305 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 568 (T568M)

Ref Sequence

ENSEMBL: ENSMUSP00000153526 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080418] [ENSMUST00000163516] [ENSMUST00000224347] [ENSMUST00000226058]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000080418
AA Change: T568M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000079280
Gene: ENSMUSG00000024589
AA Change: T568M

Domain	Start	End	E-Value	Type
PDB:3M7F\|B	1	64	2e-21	PDB
WW	73	105	2.32e-13	SMART
low complexity region	139	154	N/A	INTRINSIC
low complexity region	166	178	N/A	INTRINSIC
low complexity region	234	247	N/A	INTRINSIC
WW	266	298	2.08e-15	SMART
low complexity region	355	371	N/A	INTRINSIC
WW	378	410	4.1e-14	SMART
WW	429	461	1.53e-13	SMART
HECTc	518	854	3.04e-183	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000163516
AA Change: T689M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000132838
Gene: ENSMUSG00000024589
AA Change: T689M

Domain	Start	End	E-Value	Type
C2	21	124	1.76e-25	SMART
WW	194	226	2.32e-13	SMART
low complexity region	260	275	N/A	INTRINSIC
low complexity region	287	299	N/A	INTRINSIC
low complexity region	355	368	N/A	INTRINSIC
WW	387	419	2.08e-15	SMART
low complexity region	476	492	N/A	INTRINSIC
WW	499	531	4.1e-14	SMART
WW	550	582	1.53e-13	SMART
HECTc	639	975	3.04e-183	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000224347
AA Change: T548M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224663

Predicted Effect

probably damaging
Transcript: ENSMUST00000226058
AA Change: T568M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.1335

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.9%
20x: 91.0%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Nedd4 family of HECT domain E3 ubiquitin ligases. HECT domain E3 ubiquitin ligases transfer ubiquitin from E2 ubiquitin-conjugating enzymes to protein substrates, thus targeting specific proteins for lysosomal degradation. The encoded protein mediates the ubiquitination of multiple target substrates and plays a critical role in epithelial sodium transport by regulating the cell surface expression of the epithelial sodium channel, ENaC. Single nucleotide polymorphisms in this gene may be associated with essential hypertension. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a null mutation display salt sensitive hypertension and high salt diet induced cardiac hypertrophy. A spontaneous mutation results in overt diabetes insipidus. Mice homozygous for a knock-out allele exhibit neonatal lethality with primary atelectasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
C1qtnf2	G	A	11: 43,486,053	R84Q	possibly damaging	Het
Carmil2	T	A	8: 105,694,006		probably null	Het
Cenpf	A	T	1: 189,683,808	C107S	probably benign	Het
Cideb	T	C	14: 55,754,525	M191V	probably benign	Het
Cope	C	A	8: 70,310,447	R213S	possibly damaging	Het
Ctcf	T	C	8: 105,681,498		probably benign	Het
Daam2	T	C	17: 49,476,461	Y647C	probably damaging	Het
Dlg2	T	C	7: 92,442,686	Y920H	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Fdps	C	A	3: 89,099,403	R127L	probably damaging	Het
G6pd2	C	T	5: 61,810,352	T490I	probably benign	Het
Gm6401	A	G	14: 41,965,506	M121T	probably damaging	Het
Gnl2	T	C	4: 125,053,536		probably null	Het
Gprc5c	G	T	11: 114,864,267	V257L	possibly damaging	Het
Gtf2a1l	A	G	17: 88,694,645	S310G	possibly damaging	Het
H2afy	A	G	13: 56,088,293	V213A	possibly damaging	Het
Igdcc4	T	C	9: 65,124,701	F500L	probably damaging	Het
Lgr4	A	T	2: 109,997,595	H207L	probably damaging	Het
Llcfc1	A	G	6: 41,685,376	M105V	probably benign	Het
Map2k3	A	G	11: 60,941,882	K18E	probably damaging	Het
Mccc1	T	A	3: 35,972,564	D528V	probably benign	Het
Nr3c1	A	C	18: 39,486,601	I211S	possibly damaging	Het
Nudt5	C	T	2: 5,854,829		probably benign	Het
Olfr1176	T	C	2: 88,340,110	Y182H	probably benign	Het
Olfr704	T	A	7: 106,865,388	M136K	probably damaging	Het
Olfr771	T	C	10: 129,160,237	Y249C	probably damaging	Het
Olfr826	A	T	10: 130,180,308	S191T	probably benign	Het
Pcid2	A	T	8: 13,079,648	F326I	probably damaging	Het
Pcnt	A	T	10: 76,401,444	I1336N	probably damaging	Het
Pomk	T	C	8: 25,986,376	D50G	probably benign	Het
Ppp2r2a	T	C	14: 67,023,097	Y244C	probably damaging	Het
Ptprz1	A	G	6: 23,000,028	T706A	probably benign	Het
Rad54l	G	A	4: 116,099,764		probably benign	Het
Raph1	T	C	1: 60,533,300	D36G	probably damaging	Het
Rgs7	A	G	1: 175,076,850	S166P	possibly damaging	Het
Rnf183	C	G	4: 62,428,228	R111P	probably damaging	Het
Rp1l1	A	T	14: 64,027,946	D327V	probably damaging	Het
Rpl3l	A	G	17: 24,732,437	Y156C	probably damaging	Het
Slc25a54	G	T	3: 109,112,864	C398F	probably benign	Het
Slc39a2	A	G	14: 51,895,531	*310W	probably null	Het
Slit3	T	C	11: 35,612,367	C464R	probably damaging	Het
Smu1	A	T	4: 40,743,104	F345I	possibly damaging	Het
Ssc5d	T	A	7: 4,936,665	V700E	probably benign	Het
Stxbp3	T	C	3: 108,794,927	Y521C	probably benign	Het
Tenm4	T	C	7: 96,843,149	S1061P	probably damaging	Het
Thoc5	T	C	11: 4,910,630	S103P	probably damaging	Het
Tmem221	A	G	8: 71,555,878	F173L	probably benign	Het
Trit1	T	C	4: 123,054,313		probably benign	Het
Ttc23l	G	T	15: 10,551,550	T30K	possibly damaging	Het
Vmn2r106	T	C	17: 20,279,133		probably null	Het
Vmn2r38	C	A	7: 9,075,170	V738L	possibly damaging	Het
Zfp160	T	A	17: 21,026,761	H524Q	probably damaging	Het
Zfp791	T	A	8: 85,110,630	K202*	probably null	Het
Zfp985	T	A	4: 147,584,155	S493R	probably damaging	Het
Zkscan7	T	C	9: 122,896,133		probably benign	Het
Zwilch	A	C	9: 64,153,584	F329V	probably damaging	Het

Other mutations in Nedd4l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00501:Nedd4l	APN	18	65208092	missense	probably damaging	1.00
IGL00931:Nedd4l	APN	18	65172399	missense	possibly damaging	0.57
IGL02306:Nedd4l	APN	18	65172954	missense	possibly damaging	0.64
IGL02363:Nedd4l	APN	18	65208045	splice site	probably benign
IGL02440:Nedd4l	APN	18	65163173	critical splice donor site	probably null
IGL02444:Nedd4l	APN	18	65203957	splice site	probably benign
IGL02700:Nedd4l	APN	18	65209680	missense	probably damaging	1.00
IGL02943:Nedd4l	APN	18	65161652	critical splice donor site	probably null
IGL02999:Nedd4l	APN	18	65198707	missense	probably damaging	1.00
IGL03135:Nedd4l	APN	18	65205670	missense	probably damaging	1.00
IGL03373:Nedd4l	APN	18	65181320	splice site	probably benign
R0036:Nedd4l	UTSW	18	65051123	intron	probably benign
R0396:Nedd4l	UTSW	18	65161654	splice site	probably benign
R0472:Nedd4l	UTSW	18	65208461	missense	probably damaging	1.00
R0494:Nedd4l	UTSW	18	65173021	missense	possibly damaging	0.69
R0513:Nedd4l	UTSW	18	65195185	splice site	probably benign
R0609:Nedd4l	UTSW	18	65208461	missense	probably damaging	1.00
R0631:Nedd4l	UTSW	18	65208503	splice site	probably benign
R1077:Nedd4l	UTSW	18	65167499	splice site	probably benign
R1643:Nedd4l	UTSW	18	65198641	missense	probably damaging	1.00
R1722:Nedd4l	UTSW	18	65157939	missense	probably damaging	1.00
R1806:Nedd4l	UTSW	18	65212791	missense	probably damaging	1.00
R1921:Nedd4l	UTSW	18	65167575	critical splice donor site	probably null
R1986:Nedd4l	UTSW	18	65143803	missense	probably damaging	1.00
R2070:Nedd4l	UTSW	18	65212820	missense	probably damaging	1.00
R2151:Nedd4l	UTSW	18	65210330	missense	probably damaging	1.00
R2152:Nedd4l	UTSW	18	65210330	missense	probably damaging	1.00
R2154:Nedd4l	UTSW	18	65210330	missense	probably damaging	1.00
R2358:Nedd4l	UTSW	18	65209719	missense	possibly damaging	0.51
R2680:Nedd4l	UTSW	18	65163130	missense	possibly damaging	0.85
R3082:Nedd4l	UTSW	18	65178978	missense	probably benign	0.00
R3500:Nedd4l	UTSW	18	65212860	missense	probably damaging	1.00
R3711:Nedd4l	UTSW	18	65209719	missense	possibly damaging	0.51
R3712:Nedd4l	UTSW	18	65209719	missense	possibly damaging	0.51
R3874:Nedd4l	UTSW	18	65167535	missense	probably benign
R4435:Nedd4l	UTSW	18	65212825	missense	possibly damaging	0.84
R4698:Nedd4l	UTSW	18	65203880	missense	probably damaging	1.00
R4757:Nedd4l	UTSW	18	65165605	missense	probably damaging	0.98
R4783:Nedd4l	UTSW	18	65172927	missense	probably damaging	0.99
R4790:Nedd4l	UTSW	18	65203945	missense	possibly damaging	0.94
R4980:Nedd4l	UTSW	18	65080060	nonsense	probably null
R5122:Nedd4l	UTSW	18	65191447	missense	probably damaging	1.00
R5605:Nedd4l	UTSW	18	65174244	critical splice donor site	probably null
R6465:Nedd4l	UTSW	18	65155264	missense	probably benign	0.06
R6479:Nedd4l	UTSW	18	65209681	missense	probably damaging	1.00
R6622:Nedd4l	UTSW	18	65174234	missense	probably damaging	0.99
R6773:Nedd4l	UTSW	18	65167551	missense	probably benign	0.36
R7065:Nedd4l	UTSW	18	65195969	missense	probably benign	0.04
R7068:Nedd4l	UTSW	18	65205651	missense	probably damaging	1.00
R7193:Nedd4l	UTSW	18	64997370	missense	probably damaging	1.00
R7496:Nedd4l	UTSW	18	65080018	missense	possibly damaging	0.94
R7903:Nedd4l	UTSW	18	65186367	missense	probably damaging	1.00
R8123:Nedd4l	UTSW	18	65074774	missense	probably damaging	1.00
R8185:Nedd4l	UTSW	18	65209698	missense	probably damaging	1.00
R8282:Nedd4l	UTSW	18	65191489	missense	probably damaging	0.98
R8440:Nedd4l	UTSW	18	64889055	splice site	probably null
R8499:Nedd4l	UTSW	18	65209657	missense	probably damaging	0.98
R8557:Nedd4l	UTSW	18	65203915	missense	probably benign	0.00
R8801:Nedd4l	UTSW	18	65155275	missense	probably damaging	1.00
R8896:Nedd4l	UTSW	18	65165617	missense	probably benign
R9025:Nedd4l	UTSW	18	65178924	missense	probably damaging	0.98
R9040:Nedd4l	UTSW	18	65209663	missense	probably damaging	0.99
R9482:Nedd4l	UTSW	18	64887960	unclassified	probably benign
R9498:Nedd4l	UTSW	18	65161652	critical splice donor site	probably null
R9599:Nedd4l	UTSW	18	65210329	missense	probably damaging	1.00
RF013:Nedd4l	UTSW	18	65209680	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCTGATATTCCAAACAGGTTTG -3'
(R):5'- GCCATGTTGGATCAGAACTTG -3'

Sequencing Primer
(F):5'- ACATATTTGAAGAGTCCTATCGGAG -3'
(R):5'- TGTTGGATCAGAACTTGTTTTTAGAC -3'

Posted On

2017-01-25