Incidental Mutation 'R5044:Vps4b'
ID 453047
Institutional Source Beutler Lab
Gene Symbol Vps4b
Ensembl Gene ENSMUSG00000009907
Gene Name vacuolar protein sorting 4B
Synonyms Skd1, 8030489C12Rik
MMRRC Submission 042634-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.275) question?
Stock # R5044 (G1)
Quality Score 74
Status Validated
Chromosome 1
Chromosomal Location 106764071-106796728 bp(-) (GRCm38)
Type of Mutation splice site (3 bp from exon)
DNA Base Change (assembly) T to C at 106796418 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000108356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094646] [ENSMUST00000112736]
AlphaFold P46467
Predicted Effect probably null
Transcript: ENSMUST00000094646
SMART Domains Protein: ENSMUSP00000092230
Gene: ENSMUSG00000009907

DomainStartEndE-ValueType
MIT 4 82 7.95e-26 SMART
AAA 166 302 1.55e-22 SMART
Blast:AAA 322 366 3e-10 BLAST
Pfam:Vps4_C 381 441 1.4e-30 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000112736
SMART Domains Protein: ENSMUSP00000108356
Gene: ENSMUSG00000009907

DomainStartEndE-ValueType
MIT 4 82 7.95e-26 SMART
AAA 166 302 1.55e-22 SMART
Blast:AAA 322 366 3e-10 BLAST
Pfam:Vps4_C 380 441 7.6e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126057
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 96% (73/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the AAA protein family (ATPases associated with diverse cellular activities), and is the homolog of the yeast Vps4 protein. In humans, two paralogs of the yeast protein have been identified. The former share a high degree of aa sequence similarity with each other, and also with yeast Vps4 and mouse Skd1 proteins. Mouse Skd1 (suppressor of K+ transport defect 1) has been shown to be a yeast Vps4 ortholog. Functional studies indicate that both human paralogs associate with the endosomal compartments, and are involved in intracellular protein trafficking, similar to Vps4 protein in yeast. The gene encoding this paralog has been mapped to chromosome 18; the gene for the other resides on chromosome 16. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,373,323 F3387I possibly damaging Het
Acacb T A 5: 114,166,027 S170R probably benign Het
Adamtsl4 A G 3: 95,681,650 probably null Het
Adgrv1 A G 13: 81,488,931 C3464R probably benign Het
Apbb1 A T 7: 105,565,682 probably benign Het
Cad A G 5: 31,055,021 T23A probably benign Het
Cdca7 A G 2: 72,483,415 R183G probably benign Het
Cdpf1 T C 15: 85,809,312 T5A probably benign Het
Cep85 T C 4: 134,156,179 D133G probably damaging Het
Chrna9 T C 5: 65,971,016 L189P probably damaging Het
Clca1 A C 3: 145,007,928 probably null Het
Cntn1 G T 15: 92,242,995 V201F probably damaging Het
Col4a3 A G 1: 82,666,546 E352G unknown Het
Ddhd2 T C 8: 25,752,137 Y237C probably damaging Het
Dnah6 A C 6: 73,037,622 F3609V probably benign Het
Epha3 T C 16: 63,602,287 K580R possibly damaging Het
Fam135b T C 15: 71,462,711 N878S probably benign Het
Fam71e2 T C 7: 4,758,661 N351D probably benign Het
Fbn1 T G 2: 125,329,102 T1938P probably damaging Het
Foxg1 T C 12: 49,385,186 V234A probably damaging Het
Glt1d1 A T 5: 127,644,414 N55I probably benign Het
Gm17641 C A 3: 68,869,474 probably benign Het
Gm7665 A G 18: 16,274,731 noncoding transcript Het
Hgf A C 5: 16,614,894 N541T probably benign Het
Hipk2 G A 6: 38,818,879 P152S probably benign Het
Jarid2 C T 13: 44,906,565 L720F probably damaging Het
Kifc5b A G 17: 26,924,787 E511G probably damaging Het
Ldlr G A 9: 21,735,242 A235T probably benign Het
Lmln A G 16: 33,074,180 D231G possibly damaging Het
Lrp1 A G 10: 127,567,495 C2070R probably damaging Het
Mbl1 A G 14: 41,158,724 T190A possibly damaging Het
Mpdz A T 4: 81,381,697 S355T probably benign Het
Muc19 C T 15: 91,888,138 noncoding transcript Het
Mycbp2 A C 14: 103,139,235 probably null Het
Naa20 T C 2: 145,915,842 S164P probably damaging Het
Nme4 A T 17: 26,093,833 probably benign Het
Npas2 A T 1: 39,347,506 R619* probably null Het
Nudt19 G A 7: 35,555,746 T20I possibly damaging Het
Olfr1224-ps1 T A 2: 89,156,939 K79* probably null Het
Olfr1447 A G 19: 12,901,001 Y260H probably damaging Het
Pitpnc1 A G 11: 107,296,228 Y90H possibly damaging Het
Rcor2 A G 19: 7,269,785 T6A probably benign Het
Rif1 T A 2: 52,109,928 S1131R probably damaging Het
Rtkn T A 6: 83,150,991 D377E probably benign Het
Rtn4rl2 T A 2: 84,872,502 N242I probably damaging Het
Sbno2 G A 10: 80,062,188 L719F probably benign Het
Scn11a G T 9: 119,819,831 D55E probably damaging Het
Setd1b T A 5: 123,151,866 I632N unknown Het
Spaca6 A G 17: 17,831,196 T45A probably benign Het
Srpk2 A T 5: 23,524,392 D416E possibly damaging Het
Sspo A T 6: 48,466,955 probably null Het
Sycp1 A T 3: 102,845,054 I804N probably benign Het
Tdp2 G A 13: 24,831,826 R32Q probably benign Het
Tgfbr3 A G 5: 107,136,929 V618A possibly damaging Het
Tmc3 C T 7: 83,609,118 P439S probably benign Het
Tnxb A T 17: 34,717,483 D2740V probably damaging Het
Tspyl4 A G 10: 34,297,937 T142A probably benign Het
Ttn T C 2: 76,880,441 probably benign Het
Tubgcp4 T C 2: 121,173,580 L34P probably damaging Het
Tubgcp6 G T 15: 89,099,545 probably benign Het
Unc79 T A 12: 103,112,703 V1690E probably benign Het
Wtap A G 17: 12,967,638 S341P possibly damaging Het
Wwc1 T C 11: 35,883,345 T363A probably benign Het
Zbtb8a G A 4: 129,360,500 T67M probably damaging Het
Zfp865 T C 7: 5,034,669 probably benign Het
Other mutations in Vps4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1484:Vps4b UTSW 1 106779982 missense probably damaging 1.00
R1843:Vps4b UTSW 1 106778982 missense possibly damaging 0.94
R5375:Vps4b UTSW 1 106791692 missense probably benign 0.36
R5931:Vps4b UTSW 1 106777335 missense probably benign
R7311:Vps4b UTSW 1 106791704 missense probably damaging 0.99
R7514:Vps4b UTSW 1 106780502 critical splice donor site probably null
R8852:Vps4b UTSW 1 106782684 missense possibly damaging 0.63
R8860:Vps4b UTSW 1 106782684 missense possibly damaging 0.63
Z1177:Vps4b UTSW 1 106791700 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- GCCCAAACTCCGCTGTTTTG -3'
(R):5'- AGTTCCTGCTGGATTTACGGC -3'

Sequencing Primer
(F):5'- CACAGACCTTGAGGCTGAG -3'
(R):5'- CTGGATTTACGGCTCCGGAG -3'
Posted On 2017-01-25