Mutagenetix > Incidental Mutation

Incidental Mutation 'R5044:Hgf'

453050

Institutional Source

Beutler Lab

Gene Symbol

Hgf

Ensembl Gene

ENSMUSG00000028864

Gene Name

hepatocyte growth factor

Synonyms

HGF/SF, NK1, C230052L06Rik, scatter factor, NK2, SF/HGF

MMRRC Submission

042634-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5044 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

16553495-16620152 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 16614894 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Threonine at position 541 (N541T)

Ref Sequence

ENSEMBL: ENSMUSP00000143424 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030683] [ENSMUST00000196645] [ENSMUST00000199581]

AlphaFold

Q08048

Predicted Effect

probably benign
Transcript: ENSMUST00000030683
AA Change: N541T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000030683
Gene: ENSMUSG00000028864
AA Change: N541T

Domain	Start	End	E-Value	Type
low complexity region	7	25	N/A	INTRINSIC
PAN_AP	38	123	6.47e-13	SMART
KR	127	209	3.03e-46	SMART
KR	210	291	9.04e-45	SMART
KR	304	386	7.35e-45	SMART
KR	390	472	1.02e-38	SMART
Tryp_SPc	495	719	5.6e-55	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000196645
AA Change: N536T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000142517
Gene: ENSMUSG00000028864
AA Change: N536T

Domain	Start	End	E-Value	Type
low complexity region	7	25	N/A	INTRINSIC
PAN_AP	38	123	6.47e-13	SMART
KR	127	204	3.76e-42	SMART
KR	205	286	9.04e-45	SMART
KR	299	381	7.35e-45	SMART
KR	385	467	1.02e-38	SMART
Tryp_SPc	490	714	5.6e-55	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000199581
AA Change: N541T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000143424
Gene: ENSMUSG00000028864
AA Change: N541T

Domain	Start	End	E-Value	Type
low complexity region	7	25	N/A	INTRINSIC
PAN_AP	38	123	6.47e-13	SMART
KR	127	209	3.03e-46	SMART
KR	210	291	9.04e-45	SMART
KR	304	386	7.35e-45	SMART
KR	390	472	1.02e-38	SMART
Tryp_SPc	495	719	5.6e-55	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.3%

Validation Efficiency

96% (73/76)

MGI Phenotype

FUNCTION: This gene encodes a protein that binds to the hepatocyte growth factor receptor to regulate cell growth, cell motility and morphogenesis in numerous cell and tissue types. The encoded preproprotein is proteolytically processed to generate multiple protein products, including the hepatocyte growth factor alpha and beta chains, which heterodimerize to form the mature active protein. Although this protein is a member of the peptidase S1 family of serine proteases, it lacks peptidase activity. Homozygous knockout mice for this gene exhibit embryonic lethality due to impaired development of the placenta and liver. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced embryonic livers, impaired migration of dermomyotome precursors affecting skeletal muscle formation, defective navigation of hypoglossal motor axons, abnormal placentas, and prenatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	A	11: 9,373,323	F3387I	possibly damaging	Het
Acacb	T	A	5: 114,166,027	S170R	probably benign	Het
Adamtsl4	A	G	3: 95,681,650		probably null	Het
Adgrv1	A	G	13: 81,488,931	C3464R	probably benign	Het
Apbb1	A	T	7: 105,565,682		probably benign	Het
Cad	A	G	5: 31,055,021	T23A	probably benign	Het
Cdca7	A	G	2: 72,483,415	R183G	probably benign	Het
Cdpf1	T	C	15: 85,809,312	T5A	probably benign	Het
Cep85	T	C	4: 134,156,179	D133G	probably damaging	Het
Chrna9	T	C	5: 65,971,016	L189P	probably damaging	Het
Clca1	A	C	3: 145,007,928		probably null	Het
Cntn1	G	T	15: 92,242,995	V201F	probably damaging	Het
Col4a3	A	G	1: 82,666,546	E352G	unknown	Het
Ddhd2	T	C	8: 25,752,137	Y237C	probably damaging	Het
Dnah6	A	C	6: 73,037,622	F3609V	probably benign	Het
Epha3	T	C	16: 63,602,287	K580R	possibly damaging	Het
Fam135b	T	C	15: 71,462,711	N878S	probably benign	Het
Fam71e2	T	C	7: 4,758,661	N351D	probably benign	Het
Fbn1	T	G	2: 125,329,102	T1938P	probably damaging	Het
Foxg1	T	C	12: 49,385,186	V234A	probably damaging	Het
Glt1d1	A	T	5: 127,644,414	N55I	probably benign	Het
Gm17641	C	A	3: 68,869,474		probably benign	Het
Gm7665	A	G	18: 16,274,731		noncoding transcript	Het
Hipk2	G	A	6: 38,818,879	P152S	probably benign	Het
Jarid2	C	T	13: 44,906,565	L720F	probably damaging	Het
Kifc5b	A	G	17: 26,924,787	E511G	probably damaging	Het
Ldlr	G	A	9: 21,735,242	A235T	probably benign	Het
Lmln	A	G	16: 33,074,180	D231G	possibly damaging	Het
Lrp1	A	G	10: 127,567,495	C2070R	probably damaging	Het
Mbl1	A	G	14: 41,158,724	T190A	possibly damaging	Het
Mpdz	A	T	4: 81,381,697	S355T	probably benign	Het
Muc19	C	T	15: 91,888,138		noncoding transcript	Het
Mycbp2	A	C	14: 103,139,235		probably null	Het
Naa20	T	C	2: 145,915,842	S164P	probably damaging	Het
Nme4	A	T	17: 26,093,833		probably benign	Het
Npas2	A	T	1: 39,347,506	R619*	probably null	Het
Nudt19	G	A	7: 35,555,746	T20I	possibly damaging	Het
Olfr1224-ps1	T	A	2: 89,156,939	K79*	probably null	Het
Olfr1447	A	G	19: 12,901,001	Y260H	probably damaging	Het
Pitpnc1	A	G	11: 107,296,228	Y90H	possibly damaging	Het
Rcor2	A	G	19: 7,269,785	T6A	probably benign	Het
Rif1	T	A	2: 52,109,928	S1131R	probably damaging	Het
Rtkn	T	A	6: 83,150,991	D377E	probably benign	Het
Rtn4rl2	T	A	2: 84,872,502	N242I	probably damaging	Het
Sbno2	G	A	10: 80,062,188	L719F	probably benign	Het
Scn11a	G	T	9: 119,819,831	D55E	probably damaging	Het
Setd1b	T	A	5: 123,151,866	I632N	unknown	Het
Spaca6	A	G	17: 17,831,196	T45A	probably benign	Het
Srpk2	A	T	5: 23,524,392	D416E	possibly damaging	Het
Sspo	A	T	6: 48,466,955		probably null	Het
Sycp1	A	T	3: 102,845,054	I804N	probably benign	Het
Tdp2	G	A	13: 24,831,826	R32Q	probably benign	Het
Tgfbr3	A	G	5: 107,136,929	V618A	possibly damaging	Het
Tmc3	C	T	7: 83,609,118	P439S	probably benign	Het
Tnxb	A	T	17: 34,717,483	D2740V	probably damaging	Het
Tspyl4	A	G	10: 34,297,937	T142A	probably benign	Het
Ttn	T	C	2: 76,880,441		probably benign	Het
Tubgcp4	T	C	2: 121,173,580	L34P	probably damaging	Het
Tubgcp6	G	T	15: 89,099,545		probably benign	Het
Unc79	T	A	12: 103,112,703	V1690E	probably benign	Het
Vps4b	T	C	1: 106,796,418		probably null	Het
Wtap	A	G	17: 12,967,638	S341P	possibly damaging	Het
Wwc1	T	C	11: 35,883,345	T363A	probably benign	Het
Zbtb8a	G	A	4: 129,360,500	T67M	probably damaging	Het
Zfp865	T	C	7: 5,034,669		probably benign	Het

Other mutations in Hgf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00333:Hgf	APN	5	16611882	missense	possibly damaging	0.70
IGL00427:Hgf	APN	5	16578486	missense	probably benign	0.09
IGL00788:Hgf	APN	5	16598230	missense	probably damaging	0.99
IGL01290:Hgf	APN	5	16604846	missense	probably damaging	1.00
IGL01333:Hgf	APN	5	16576941	nonsense	probably null
IGL01568:Hgf	APN	5	16564814	missense	probably damaging	1.00
IGL02314:Hgf	APN	5	16572602	missense	probably damaging	0.99
IGL02328:Hgf	APN	5	16598221	missense	probably damaging	1.00
IGL02368:Hgf	APN	5	16564794	missense	possibly damaging	0.95
IGL02486:Hgf	APN	5	16602289	missense	probably damaging	1.00
IGL02654:Hgf	APN	5	16561051	missense	probably benign
Foiegras	UTSW	5	16615802	missense	probably benign	0.01
PIT4378001:Hgf	UTSW	5	16611862	missense	probably damaging	1.00
R0708:Hgf	UTSW	5	16566763	nonsense	probably null
R0710:Hgf	UTSW	5	16566763	nonsense	probably null
R0718:Hgf	UTSW	5	16593859	missense	probably damaging	1.00
R0967:Hgf	UTSW	5	16593841	splice site	probably benign
R1181:Hgf	UTSW	5	16618925	missense	probably damaging	1.00
R1589:Hgf	UTSW	5	16613785	missense	probably damaging	1.00
R1705:Hgf	UTSW	5	16615802	missense	probably benign	0.01
R1983:Hgf	UTSW	5	16561012	missense	possibly damaging	0.53
R2021:Hgf	UTSW	5	16576921	missense	probably benign
R2441:Hgf	UTSW	5	16604790	missense	probably damaging	0.99
R4083:Hgf	UTSW	5	16615858	nonsense	probably null
R4084:Hgf	UTSW	5	16615858	nonsense	probably null
R4211:Hgf	UTSW	5	16614993	missense	probably damaging	0.99
R4388:Hgf	UTSW	5	16614943	missense	probably benign	0.12
R4394:Hgf	UTSW	5	16618951	nonsense	probably null
R4575:Hgf	UTSW	5	16572601	missense	probably benign
R5319:Hgf	UTSW	5	16566862	critical splice donor site	probably null
R5585:Hgf	UTSW	5	16564801	missense	possibly damaging	0.93
R5700:Hgf	UTSW	5	16610124	missense	probably damaging	1.00
R5814:Hgf	UTSW	5	16602307	missense	probably benign	0.19
R6125:Hgf	UTSW	5	16598161	missense	probably damaging	1.00
R6749:Hgf	UTSW	5	16613642	splice site	probably null
R6891:Hgf	UTSW	5	16604922	critical splice donor site	probably null
R6962:Hgf	UTSW	5	16615754	missense	probably benign	0.32
R7251:Hgf	UTSW	5	16593944	missense	possibly damaging	0.95
R7296:Hgf	UTSW	5	16564843	missense	probably benign	0.39
R7463:Hgf	UTSW	5	16578450	missense	probably benign	0.00
R7470:Hgf	UTSW	5	16618856	missense	probably benign	0.02
R7630:Hgf	UTSW	5	16598250	missense	probably benign	0.01
R7807:Hgf	UTSW	5	16577011	missense	probably damaging	0.99
R8098:Hgf	UTSW	5	16561061	missense	probably benign	0.04
R8120:Hgf	UTSW	5	16613781	missense	probably damaging	1.00
R8132:Hgf	UTSW	5	16602331	missense	probably damaging	1.00
R8499:Hgf	UTSW	5	16566856	missense	probably damaging	0.99
R8929:Hgf	UTSW	5	16593990	missense	probably benign	0.44
R9016:Hgf	UTSW	5	16618958	missense	probably damaging	1.00
R9126:Hgf	UTSW	5	16560981	missense	possibly damaging	0.95
R9197:Hgf	UTSW	5	16561061	missense	probably benign	0.04
R9347:Hgf	UTSW	5	16604923	critical splice donor site	probably null
R9478:Hgf	UTSW	5	16561031	missense	possibly damaging	0.70
R9696:Hgf	UTSW	5	16572536	missense	probably damaging	1.00
R9729:Hgf	UTSW	5	16561031	missense	probably damaging	0.97
R9732:Hgf	UTSW	5	16615750	missense	probably damaging	1.00
X0024:Hgf	UTSW	5	16604828	missense	probably damaging	1.00
Z1088:Hgf	UTSW	5	16618919	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAGTTTCTTCAACTTCAAAGCC -3'
(R):5'- AGCAGCTGAACGTTTTAGTAAATC -3'

Sequencing Primer
(F):5'- AAAGCCTTTCCTGTCTCAGTACAC -3'
(R):5'- CATAGACCAGCTGGGAAA -3'

Posted On

2017-01-25