Incidental Mutation 'R5091:Agbl4'
ID453053
Institutional Source Beutler Lab
Gene Symbol Agbl4
Ensembl Gene ENSMUSG00000061298
Gene NameATP/GTP binding protein-like 4
Synonyms4931433A01Rik, 4930578N11Rik
MMRRC Submission 042680-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5091 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location110397661-111664324 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111119040 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 198 (V198A)
Ref Sequence ENSEMBL: ENSMUSP00000102202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080744] [ENSMUST00000097920] [ENSMUST00000106591] [ENSMUST00000106592]
Predicted Effect possibly damaging
Transcript: ENSMUST00000080744
AA Change: V198A

PolyPhen 2 Score 0.507 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000079568
Gene: ENSMUSG00000061298
AA Change: V198A

DomainStartEndE-ValueType
Zn_pept 169 436 4.95e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000097920
AA Change: V198A

PolyPhen 2 Score 0.507 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000095533
Gene: ENSMUSG00000061298
AA Change: V198A

DomainStartEndE-ValueType
Zn_pept 169 465 3.6e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106591
AA Change: V198A

PolyPhen 2 Score 0.541 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000102201
Gene: ENSMUSG00000061298
AA Change: V198A

DomainStartEndE-ValueType
Pfam:Peptidase_M14 174 321 3.7e-33 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106592
AA Change: V198A

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102202
Gene: ENSMUSG00000061298
AA Change: V198A

DomainStartEndE-ValueType
Zn_pept 169 436 4.95e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136433
Predicted Effect unknown
Transcript: ENSMUST00000148038
AA Change: V43A
SMART Domains Protein: ENSMUSP00000118551
Gene: ENSMUSG00000061298
AA Change: V43A

DomainStartEndE-ValueType
Zn_pept 15 267 9.65e-4 SMART
Meta Mutation Damage Score 0.2253 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 96% (67/70)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal platelet morphology and physiology, impaired megakaryopoiesis, increased spleen weight and increased susceptibility to HSV or VACV infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833439L19Rik A G 13: 54,553,244 S174P probably damaging Het
4931414P19Rik T C 14: 54,585,711 E343G probably damaging Het
9530053A07Rik A C 7: 28,156,958 I2057L probably benign Het
Abca14 T C 7: 120,252,274 V825A probably damaging Het
Abca8b G T 11: 109,936,384 T1466K possibly damaging Het
Adcy8 A G 15: 64,806,704 S467P probably damaging Het
Agpat4 A G 17: 12,198,812 K80R probably benign Het
Akap8 T C 17: 32,316,234 T269A probably benign Het
Ankhd1 A T 18: 36,625,027 I925F possibly damaging Het
Aste1 A G 9: 105,405,004 Y57C probably damaging Het
Axdnd1 A G 1: 156,420,410 S7P possibly damaging Het
BC051019 T A 7: 109,720,582 R91S probably null Het
Cavin2 C A 1: 51,301,239 N358K probably benign Het
Cd2 T C 3: 101,283,039 N196S probably benign Het
Clca3a1 C T 3: 144,730,722 V867I probably benign Het
Col6a4 T A 9: 106,075,063 K545N probably damaging Het
Cps1 T A 1: 67,229,520 probably null Het
Cyp2c65 A T 19: 39,087,565 probably null Het
Dcaf6 T C 1: 165,330,003 D856G possibly damaging Het
E130309D02Rik C T 5: 143,307,688 E345K possibly damaging Het
Epcam T C 17: 87,642,152 I181T probably damaging Het
Esrp2 A G 8: 106,132,429 S562P probably damaging Het
Ffar4 A G 19: 38,097,179 D18G probably benign Het
Gen1 C T 12: 11,246,346 V337I probably damaging Het
Gimap8 C T 6: 48,656,647 P467S possibly damaging Het
Gnl3 T A 14: 31,016,846 H82L possibly damaging Het
Grid2 T C 6: 64,076,878 S354P probably benign Het
Ighmbp2 T A 19: 3,265,084 T779S possibly damaging Het
Kif19a C A 11: 114,783,097 T348N probably damaging Het
Lrrc15 T A 16: 30,273,354 N389I probably damaging Het
Mrps26 A G 2: 130,563,966 Y63C probably damaging Het
Myd88 C A 9: 119,337,823 V223F possibly damaging Het
Nox4 T A 7: 87,376,242 W526R probably damaging Het
Nrg2 A T 18: 36,052,785 N300K probably damaging Het
Nsmf T C 2: 25,060,452 probably benign Het
Patl2 A C 2: 122,123,802 H429Q probably benign Het
Pcdhb12 A T 18: 37,435,854 K18* probably null Het
Peg10 T A 6: 4,754,511 D97E probably benign Het
Runx1t1 C T 4: 13,846,830 Q205* probably null Het
Selenon T C 4: 134,547,973 K138R probably damaging Het
Slc13a3 T C 2: 165,420,080 E369G probably benign Het
Sorcs1 A G 19: 50,259,752 probably null Het
Sptbn4 A T 7: 27,369,391 M499K probably damaging Het
Sra1 A T 18: 36,669,959 probably benign Het
Stra6 T C 9: 58,141,146 L174P probably damaging Het
Syngr1 T C 15: 80,115,885 Y66H probably damaging Het
Synpo G T 18: 60,602,759 S466* probably null Het
Tenm3 T A 8: 48,342,308 M595L probably benign Het
Tnks T C 8: 34,841,809 T1099A probably benign Het
Tram1l1 G T 3: 124,321,751 V187F possibly damaging Het
Trappc11 T C 8: 47,512,604 E529G probably benign Het
Usp17la T C 7: 104,860,932 V248A probably damaging Het
Virma T C 4: 11,519,392 Y880H probably benign Het
Vmn1r214 C T 13: 23,035,401 T355I possibly damaging Het
Vmn2r7 T C 3: 64,690,784 K784R possibly damaging Het
Wrap53 C T 11: 69,562,447 W389* probably null Het
Zfp748 A G 13: 67,541,519 S541P probably damaging Het
Other mutations in Agbl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00548:Agbl4 APN 4 111118884 missense probably damaging 1.00
IGL02961:Agbl4 APN 4 110580121 missense probably damaging 1.00
IGL03383:Agbl4 APN 4 111657423 intron probably benign
IGL03401:Agbl4 APN 4 111119019 missense probably damaging 0.99
I1329:Agbl4 UTSW 4 110478455 splice site probably benign
R0277:Agbl4 UTSW 4 111617222 missense probably damaging 1.00
R0323:Agbl4 UTSW 4 111617222 missense probably damaging 1.00
R0690:Agbl4 UTSW 4 111657388 missense probably benign 0.35
R1086:Agbl4 UTSW 4 110478594 splice site probably benign
R1099:Agbl4 UTSW 4 110955663 critical splice donor site probably null
R1172:Agbl4 UTSW 4 111656318 splice site probably benign
R1480:Agbl4 UTSW 4 111566717 missense possibly damaging 0.56
R1508:Agbl4 UTSW 4 111656398 missense probably benign 0.10
R1564:Agbl4 UTSW 4 110955564 splice site probably null
R1610:Agbl4 UTSW 4 111657168 missense probably benign 0.00
R1869:Agbl4 UTSW 4 111566629 missense possibly damaging 0.91
R1989:Agbl4 UTSW 4 111566682 missense possibly damaging 0.92
R2327:Agbl4 UTSW 4 111526601 missense probably benign 0.00
R4780:Agbl4 UTSW 4 111657331 missense possibly damaging 0.73
R4806:Agbl4 UTSW 4 110955637 missense probably damaging 1.00
R4814:Agbl4 UTSW 4 111656368 missense possibly damaging 0.60
R5077:Agbl4 UTSW 4 111566742 missense probably benign 0.00
R5079:Agbl4 UTSW 4 111566629 missense possibly damaging 0.91
R5124:Agbl4 UTSW 4 111656328 missense probably benign 0.21
R5297:Agbl4 UTSW 4 111566698 missense possibly damaging 0.92
R5645:Agbl4 UTSW 4 111657330 missense possibly damaging 0.53
R5996:Agbl4 UTSW 4 110955672 splice site probably null
R6363:Agbl4 UTSW 4 111566785 intron probably benign
R6492:Agbl4 UTSW 4 111547272 missense probably damaging 1.00
R6617:Agbl4 UTSW 4 110580135 missense probably damaging 1.00
R6709:Agbl4 UTSW 4 111566782 intron probably benign
R6873:Agbl4 UTSW 4 111566659 missense possibly damaging 0.76
R7015:Agbl4 UTSW 4 110478500 missense probably damaging 1.00
R7105:Agbl4 UTSW 4 111566723 missense probably benign 0.06
R7143:Agbl4 UTSW 4 111617136 missense probably damaging 1.00
R7413:Agbl4 UTSW 4 111657298 missense probably benign 0.23
R7489:Agbl4 UTSW 4 111526658 missense probably damaging 1.00
R7583:Agbl4 UTSW 4 111118953 missense possibly damaging 0.89
R7796:Agbl4 UTSW 4 110660968 missense unknown
R8023:Agbl4 UTSW 4 111617148 missense probably benign 0.05
R8058:Agbl4 UTSW 4 110660842 missense unknown
R8342:Agbl4 UTSW 4 111119027 missense probably damaging 1.00
R8366:Agbl4 UTSW 4 111566664 missense probably damaging 1.00
R8691:Agbl4 UTSW 4 111662959 missense probably benign 0.03
Z1176:Agbl4 UTSW 4 110660839 missense probably damaging 1.00
Z1176:Agbl4 UTSW 4 111526643 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACAGGAAGAACTATGTGATGTC -3'
(R):5'- GCCCTTGGAGCAATGAATCAC -3'

Sequencing Primer
(F):5'- CAGGAAGAACTATGTGATGTCCTTTG -3'
(R):5'- CCTTGGAGCAATGAATCACACTTTC -3'
Posted On2017-01-26