Mutagenetix > Incidental Mutation

Incidental Mutation 'IGL03138:Knl1'

453067

Institutional Source

Beutler Lab

Gene Symbol

Knl1

Ensembl Gene

ENSMUSG00000027326

Gene Name

kinetochore scaffold 1

Synonyms

2310043D08Rik, 5730505K17Rik

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

IGL03138 (G1)

Quality Score

164

Status

Validated

Chromosome

Chromosomal Location

119047119-119105501 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 119072359 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Phenylalanine at position 1514 (V1514F)

Ref Sequence

ENSEMBL: ENSMUSP00000097140 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028799] [ENSMUST00000028802] [ENSMUST00000099542] [ENSMUST00000152380]

AlphaFold

Q66JQ7

Predicted Effect

probably benign
Transcript: ENSMUST00000028799
AA Change: V1514F

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000028799
Gene: ENSMUSG00000027326
AA Change: V1514F

Domain	Start	End	E-Value	Type
low complexity region	49	58	N/A	INTRINSIC
PDB:4A1G\|H	126	175	1e-13	PDB
low complexity region	426	433	N/A	INTRINSIC
low complexity region	883	894	N/A	INTRINSIC
low complexity region	1148	1159	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000028802
AA Change: V1514F

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000028802
Gene: ENSMUSG00000027326
AA Change: V1514F

Domain	Start	End	E-Value	Type
low complexity region	49	58	N/A	INTRINSIC
internal_repeat_1	98	304	1.57e-6	PROSPERO
low complexity region	426	433	N/A	INTRINSIC
internal_repeat_1	610	824	1.57e-6	PROSPERO
low complexity region	883	894	N/A	INTRINSIC
low complexity region	1148	1159	N/A	INTRINSIC
low complexity region	1621	1644	N/A	INTRINSIC
coiled coil region	1724	1755	N/A	INTRINSIC
low complexity region	1836	1850	N/A	INTRINSIC
low complexity region	1864	1878	N/A	INTRINSIC
PDB:4NF9\|B	1899	2119	1e-115	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000099542
AA Change: V1514F

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000097140
Gene: ENSMUSG00000027326
AA Change: V1514F

Domain	Start	End	E-Value	Type
low complexity region	49	58	N/A	INTRINSIC
internal_repeat_1	98	304	1.57e-6	PROSPERO
low complexity region	426	433	N/A	INTRINSIC
internal_repeat_1	610	824	1.57e-6	PROSPERO
low complexity region	883	894	N/A	INTRINSIC
low complexity region	1148	1159	N/A	INTRINSIC
low complexity region	1621	1644	N/A	INTRINSIC
coiled coil region	1724	1755	N/A	INTRINSIC
low complexity region	1836	1850	N/A	INTRINSIC
low complexity region	1864	1878	N/A	INTRINSIC
PDB:4NF9\|B	1899	2119	1e-115	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000152380

SMART Domains

Protein: ENSMUSP00000118646
Gene: ENSMUSG00000027326

Domain	Start	End	E-Value	Type
low complexity region	49	58	N/A	INTRINSIC
PDB:4A1G\|H	126	175	3e-14	PDB
low complexity region	426	433	N/A	INTRINSIC

Meta Mutation Damage Score

0.1109

Coding Region Coverage

1x: 0.0%
3x: 0.0%
10x: 0.0%
20x: 0.0%

Validation Efficiency

95% (40/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the multiprotein assembly that is required for creation of kinetochore-microtubule attachments and chromosome segregation. The encoded protein functions as a scaffold for proteins that influence the spindle assembly checkpoint during the eukaryotic cell cycle and it interacts with at least five different kinetochore proteins and two checkpoint kinases. In adults, this gene is predominantly expressed in normal testes, various cancer cell lines and primary tumors from other tissues and is ubiquitously expressed in fetal tissues. This gene was originally identified as a fusion partner with the mixed-lineage leukemia (MLL) gene in t(11;15)(q23;q14). Mutations in this gene cause autosomal recessive primary microcephaly-4 (MCPH4). Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described but their biological validity has not been confirmed. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E6. Mice homozygous for an ENU-induced allele exhibit possible embryonic lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 28 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933416I08Rik	TCC	TCCC	X: 53,690,895		noncoding transcript	Het
5330417C22Rik	T	A	3: 108,471,993	N392Y	probably benign	Het
Casd1	A	G	6: 4,613,236	H118R	probably damaging	Het
Cilp	TGGG	TGG	9: 65,280,130		probably null	Het
Cmya5	T	C	13: 93,065,342	K3371E	probably damaging	Het
Crb1	CG	C	1: 139,237,086		probably null	Het
Dpysl3	T	C	18: 43,325,794	T632A	probably benign	Het
Fbxo18	T	C	2: 11,749,509		probably benign	Het
Fcna	G	C	2: 25,630,681		probably benign	Het
Gbe1	T	A	16: 70,529,063		probably benign	Het
Gm4759	G	T	7: 106,424,443		noncoding transcript	Het
Gm4876	T	G	6: 17,171,737		noncoding transcript	Het
Hsd17b7	C	T	1: 169,953,080	E320K	probably damaging	Het
Inhba	T	A	13: 16,017,514	D73E	probably benign	Het
Kndc1	A	G	7: 139,939,878	N1717D	possibly damaging	Het
Map1b	C	T	13: 99,425,826	A2459T	unknown	Het
Mmp1a	TG	TGG	9: 7,465,083		probably null	Het
Pias2	T	C	18: 77,150,100		probably null	Het
Polr1b	T	C	2: 129,102,988	F68S	probably benign	Het
Slamf1	C	A	1: 171,777,084	Q141K	possibly damaging	Het
Speer4c	A	C	5: 15,714,216		probably benign	Het
Tpo	T	C	12: 30,074,171	T877A	probably benign	Het
Ugt1a1	AT	A	1: 88,212,371		probably null	Het
Vmn1r37	A	G	6: 66,732,188	K229R	possibly damaging	Het
Wdr17	T	C	8: 54,649,143	D947G	probably damaging	Het
Wdr61	T	C	9: 54,728,163		probably benign	Het
Wiz	G	T	17: 32,359,119	T473K	probably damaging	Het
Zmynd12	A	G	4: 119,422,989	Y35C	probably damaging	Het

Other mutations in Knl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00272:Knl1	APN	2	119064083	missense	probably damaging	0.96
IGL00582:Knl1	APN	2	119102499	missense	probably benign	0.19
IGL00666:Knl1	APN	2	119070464	missense	probably damaging	0.96
IGL01062:Knl1	APN	2	119076980	missense	probably benign	0.33
IGL01395:Knl1	APN	2	119071566	missense	probably damaging	0.96
IGL01604:Knl1	APN	2	119070001	missense	probably damaging	1.00
IGL01996:Knl1	APN	2	119104061	missense	probably damaging	1.00
IGL02086:Knl1	APN	2	119100774	missense	probably benign	0.40
IGL02105:Knl1	APN	2	119071808	missense	probably benign
IGL02106:Knl1	APN	2	119072008	missense	possibly damaging	0.89
IGL02201:Knl1	APN	2	119069152	missense	probably benign	0.01
IGL02252:Knl1	APN	2	119072540	missense	probably damaging	1.00
IGL02414:Knl1	APN	2	119070323	missense	possibly damaging	0.83
IGL02655:Knl1	APN	2	119070992	missense	possibly damaging	0.62
IGL02682:Knl1	APN	2	119077969	missense	possibly damaging	0.86
IGL02710:Knl1	APN	2	119070930	missense	probably damaging	0.99
IGL02877:Knl1	APN	2	119088831	missense	probably benign	0.08
IGL03100:Knl1	APN	2	119100770	missense	probably damaging	0.99
IGL03210:Knl1	APN	2	119070617	missense	probably benign	0.02
R0023:Knl1	UTSW	2	119102549	missense	possibly damaging	0.73
R0064:Knl1	UTSW	2	119076243	missense	probably benign	0.00
R0064:Knl1	UTSW	2	119076243	missense	probably benign	0.00
R0078:Knl1	UTSW	2	119069892	missense	probably benign	0.16
R0178:Knl1	UTSW	2	119058405	splice site	probably benign
R0295:Knl1	UTSW	2	119088839	missense	probably damaging	1.00
R0433:Knl1	UTSW	2	119104061	missense	probably damaging	0.96
R0453:Knl1	UTSW	2	119068388	missense	probably damaging	1.00
R0569:Knl1	UTSW	2	119097435	missense	possibly damaging	0.95
R0827:Knl1	UTSW	2	119088901	splice site	probably benign
R0920:Knl1	UTSW	2	119069828	missense	probably benign	0.00
R1120:Knl1	UTSW	2	119062375	missense	probably damaging	0.99
R1155:Knl1	UTSW	2	119071154	missense	possibly damaging	0.90
R1204:Knl1	UTSW	2	119071189	missense	probably benign	0.00
R1241:Knl1	UTSW	2	119072573	missense	probably benign	0.03
R1387:Knl1	UTSW	2	119070730	missense	possibly damaging	0.93
R1448:Knl1	UTSW	2	119068307	missense	probably damaging	1.00
R1469:Knl1	UTSW	2	119071346	missense	possibly damaging	0.73
R1469:Knl1	UTSW	2	119071346	missense	possibly damaging	0.73
R1719:Knl1	UTSW	2	119071738	missense	probably benign	0.01
R1721:Knl1	UTSW	2	119076334	missense	probably damaging	1.00
R2128:Knl1	UTSW	2	119071819	missense	possibly damaging	0.79
R2170:Knl1	UTSW	2	119087594	critical splice donor site	probably null
R2227:Knl1	UTSW	2	119072000	missense	probably damaging	0.97
R2246:Knl1	UTSW	2	119072227	missense	probably damaging	1.00
R2275:Knl1	UTSW	2	119072281	missense	probably damaging	0.99
R2508:Knl1	UTSW	2	119058368	nonsense	probably null
R3115:Knl1	UTSW	2	119070391	missense	possibly damaging	0.53
R3122:Knl1	UTSW	2	119068944	missense	probably benign	0.32
R3431:Knl1	UTSW	2	119062362	missense	probably damaging	1.00
R3755:Knl1	UTSW	2	119102579	missense	probably damaging	1.00
R4461:Knl1	UTSW	2	119059599	missense	probably benign	0.00
R4600:Knl1	UTSW	2	119070544	missense	possibly damaging	0.90
R4713:Knl1	UTSW	2	119069137	nonsense	probably null
R4758:Knl1	UTSW	2	119071732	frame shift	probably null
R4762:Knl1	UTSW	2	119071936	missense	probably benign	0.01
R4869:Knl1	UTSW	2	119072351	missense	possibly damaging	0.73
R4870:Knl1	UTSW	2	119081513	missense	probably benign	0.22
R4935:Knl1	UTSW	2	119068957	missense	possibly damaging	0.50
R5167:Knl1	UTSW	2	119070031	missense	probably damaging	1.00
R5184:Knl1	UTSW	2	119069176	missense	probably damaging	1.00
R5293:Knl1	UTSW	2	119069695	missense	probably damaging	0.99
R5326:Knl1	UTSW	2	119068348	missense	possibly damaging	0.66
R5331:Knl1	UTSW	2	119070255	missense	possibly damaging	0.92
R5353:Knl1	UTSW	2	119070983	missense	probably benign	0.01
R5493:Knl1	UTSW	2	119068730	missense	probably damaging	0.98
R5542:Knl1	UTSW	2	119068348	missense	possibly damaging	0.66
R5632:Knl1	UTSW	2	119070352	missense	probably damaging	1.00
R5650:Knl1	UTSW	2	119081550	nonsense	probably null
R5854:Knl1	UTSW	2	119070403	missense	probably benign	0.02
R5979:Knl1	UTSW	2	119069360	missense	possibly damaging	0.83
R6086:Knl1	UTSW	2	119094068	missense	probably damaging	1.00
R6283:Knl1	UTSW	2	119070286	missense	probably damaging	1.00
R6285:Knl1	UTSW	2	119071941	missense	probably damaging	1.00
R6313:Knl1	UTSW	2	119069318	missense	probably damaging	1.00
R6419:Knl1	UTSW	2	119069003	missense	probably benign	0.02
R6608:Knl1	UTSW	2	119086612	missense	probably damaging	0.99
R6881:Knl1	UTSW	2	119095184	missense	possibly damaging	0.67
R7161:Knl1	UTSW	2	119070785	missense	possibly damaging	0.79
R7206:Knl1	UTSW	2	119069299	missense	probably benign	0.35
R7270:Knl1	UTSW	2	119102522	missense	possibly damaging	0.53
R7276:Knl1	UTSW	2	119071686	missense	probably damaging	0.98
R7358:Knl1	UTSW	2	119070559	missense	possibly damaging	0.92
R7402:Knl1	UTSW	2	119095226	nonsense	probably null
R7408:Knl1	UTSW	2	119070592	missense	possibly damaging	0.54
R7475:Knl1	UTSW	2	119087546	missense	probably damaging	1.00
R7516:Knl1	UTSW	2	119070698	missense	probably damaging	0.99
R7524:Knl1	UTSW	2	119065979	missense	probably damaging	1.00
R7559:Knl1	UTSW	2	119094006	missense	possibly damaging	0.84
R7607:Knl1	UTSW	2	119095133	missense	possibly damaging	0.93
R7745:Knl1	UTSW	2	119071556	missense	probably benign	0.13
R7847:Knl1	UTSW	2	119070976	missense	probably benign	0.02
R8423:Knl1	UTSW	2	119070032	missense	probably damaging	1.00
R8725:Knl1	UTSW	2	119069043	missense	probably benign	0.34
R8727:Knl1	UTSW	2	119069043	missense	probably benign	0.34
R8995:Knl1	UTSW	2	119072509	missense	probably benign	0.11
R9023:Knl1	UTSW	2	119070280	missense	probably benign	0.27
R9100:Knl1	UTSW	2	119068988	missense	probably benign	0.02
R9102:Knl1	UTSW	2	119087492	missense	probably benign	0.22
R9303:Knl1	UTSW	2	119068348	missense	possibly damaging	0.83
R9400:Knl1	UTSW	2	119100743	missense	probably damaging	0.98
R9426:Knl1	UTSW	2	119069498	missense	possibly damaging	0.81
R9583:Knl1	UTSW	2	119057301	missense	probably damaging	1.00
R9616:Knl1	UTSW	2	119069513	missense	probably benign	0.02
R9616:Knl1	UTSW	2	119076944	missense	probably damaging	1.00
R9671:Knl1	UTSW	2	119070608	missense	probably damaging	1.00
R9766:Knl1	UTSW	2	119069900	missense	probably damaging	1.00
R9782:Knl1	UTSW	2	119069429	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- GGCTGAAACTACATCTGTACCAC -3'
(R):5'- ACATCATTTTCTTCAACCCGGG -3'

Sequencing Primer
(F):5'- TACATCTGTACCACTAAAAACAGCTG -3'
(R):5'- TGGGCCCTGCAGTTTTC -3'

Posted On

2017-01-27