Incidental Mutation 'R0553:Fbxl17'
ID 45307
Institutional Source Beutler Lab
Gene Symbol Fbxl17
Ensembl Gene ENSMUSG00000023965
Gene Name F-box and leucine-rich repeat protein 17
Synonyms 6330576B01Rik, Fbxo13, Fbx13, C130023C01Rik
MMRRC Submission 038745-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.834) question?
Stock # R0553 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 63057452-63500017 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 63356851 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 67 (R67C)
Ref Sequence ENSEMBL: ENSMUSP00000108459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024761] [ENSMUST00000112840]
AlphaFold Q9QZN1
Predicted Effect probably benign
Transcript: ENSMUST00000024761
AA Change: R548C

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000024761
Gene: ENSMUSG00000023965
AA Change: R548C

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
low complexity region 76 89 N/A INTRINSIC
low complexity region 103 138 N/A INTRINSIC
low complexity region 180 193 N/A INTRINSIC
low complexity region 214 245 N/A INTRINSIC
low complexity region 246 270 N/A INTRINSIC
FBOX 324 365 3.1e-8 SMART
LRR 359 384 4.6e-1 SMART
LRR 385 410 2e-1 SMART
LRR 411 436 8.5e-2 SMART
LRR 437 462 6.9e-4 SMART
LRR 463 488 1.3e-5 SMART
LRR 489 514 5.2e-2 SMART
LRR 515 539 2.9e-3 SMART
LRR 540 564 2e-1 SMART
low complexity region 567 580 N/A INTRINSIC
LRR 591 615 8.4e-4 SMART
LRR 616 641 2.2e-1 SMART
LRR 642 667 6.3e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000112839
Predicted Effect probably damaging
Transcript: ENSMUST00000112840
AA Change: R67C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108459
Gene: ENSMUSG00000023965
AA Change: R67C

DomainStartEndE-ValueType
LRR 8 33 1.2e1 SMART
LRR 34 58 6.57e-1 SMART
LRR 59 83 4.67e1 SMART
low complexity region 86 99 N/A INTRINSIC
LRR 110 134 1.89e-1 SMART
LRR 135 160 5.25e1 SMART
LRR 161 186 1.47e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169134
Meta Mutation Damage Score 0.4300 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the F-box protein family, such as FBXL17, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,682,686 I729V probably damaging Het
9530002B09Rik A T 4: 122,702,335 M120L unknown Het
Adamts13 T A 2: 26,991,334 C774* probably null Het
Amh A G 10: 80,806,176 probably benign Het
Ccdc173 C A 2: 69,789,441 R8L probably damaging Het
Cd40 G A 2: 165,070,741 R204Q probably benign Het
Clhc1 A C 11: 29,561,366 probably benign Het
Flg2 A T 3: 93,203,584 H973L unknown Het
Fut2 T A 7: 45,651,274 I25F probably damaging Het
Galnt7 T C 8: 57,552,430 probably benign Het
Gm438 T A 4: 144,777,415 I389L possibly damaging Het
Gm7534 T C 4: 134,202,518 T159A possibly damaging Het
Gm8909 G T 17: 36,168,057 P100Q probably damaging Het
Gmppb A T 9: 108,049,797 M56L probably benign Het
Grm3 C A 5: 9,570,048 A399S probably benign Het
Hey2 G A 10: 30,840,489 probably benign Het
Ift172 A G 5: 31,275,842 probably benign Het
Kcnh5 C A 12: 75,137,673 C92F probably benign Het
Kdm1a T C 4: 136,555,298 D229G probably damaging Het
Klf11 C G 12: 24,655,090 P164R probably benign Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Krtcap3 T C 5: 31,251,803 V6A probably benign Het
Ltbr A C 6: 125,313,388 probably null Het
Mmp17 T G 5: 129,598,670 S298A probably benign Het
Nacc2 T A 2: 26,089,590 E278V possibly damaging Het
Olfr175-ps1 A T 16: 58,824,155 Y185N probably damaging Het
Olfr875 T A 9: 37,773,331 I224N probably benign Het
Otop2 C T 11: 115,329,462 A376V probably damaging Het
Pdia2 T C 17: 26,196,243 E504G probably damaging Het
Pdzph1 C T 17: 58,922,727 V979M probably damaging Het
Pou5f1 A G 17: 35,509,477 K86R possibly damaging Het
Ptprq A G 10: 107,710,627 F269L probably benign Het
Rb1 A T 14: 73,211,712 C659* probably null Het
Rnf8 T C 17: 29,621,639 probably null Het
Rras T G 7: 45,020,556 I137M probably benign Het
Slc38a9 A T 13: 112,714,198 H372L probably damaging Het
Spata9 T C 13: 75,977,779 probably null Het
Tas2r115 T C 6: 132,737,959 T10A probably benign Het
Ttn T C 2: 76,798,893 E12621G probably damaging Het
Unc80 A T 1: 66,506,669 I460F probably damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Zbtb24 C T 10: 41,451,997 A293V possibly damaging Het
Other mutations in Fbxl17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Fbxl17 APN 17 63385052 missense probably damaging 1.00
IGL02201:Fbxl17 APN 17 63499029 missense probably damaging 1.00
IGL02256:Fbxl17 APN 17 63499090 missense probably benign
IGL03408:Fbxl17 APN 17 63080546 nonsense probably null
R0268:Fbxl17 UTSW 17 63385067 splice site probably benign
R0269:Fbxl17 UTSW 17 63384992 missense probably damaging 0.99
R0313:Fbxl17 UTSW 17 63356851 missense probably damaging 1.00
R0315:Fbxl17 UTSW 17 63356851 missense probably damaging 1.00
R0344:Fbxl17 UTSW 17 63385067 splice site probably benign
R0356:Fbxl17 UTSW 17 63356851 missense probably damaging 1.00
R0358:Fbxl17 UTSW 17 63356851 missense probably damaging 1.00
R0617:Fbxl17 UTSW 17 63384992 missense probably damaging 0.99
R0629:Fbxl17 UTSW 17 63471414 missense probably damaging 1.00
R1597:Fbxl17 UTSW 17 63487818 missense probably damaging 1.00
R1666:Fbxl17 UTSW 17 63385065 splice site probably null
R3001:Fbxl17 UTSW 17 63225077 missense probably damaging 0.99
R3002:Fbxl17 UTSW 17 63225077 missense probably damaging 0.99
R3121:Fbxl17 UTSW 17 63471424 missense probably damaging 0.96
R3909:Fbxl17 UTSW 17 63499807 missense possibly damaging 0.93
R4789:Fbxl17 UTSW 17 63487915 missense probably benign 0.40
R6606:Fbxl17 UTSW 17 63487788 missense probably damaging 0.97
R7153:Fbxl17 UTSW 17 63060351 missense probably benign 0.09
R7722:Fbxl17 UTSW 17 63356828 missense probably damaging 0.99
R7794:Fbxl17 UTSW 17 63356811 missense probably damaging 0.97
R7841:Fbxl17 UTSW 17 63487825 missense probably damaging 1.00
R8076:Fbxl17 UTSW 17 63060365 missense probably damaging 0.99
R8178:Fbxl17 UTSW 17 63487972 splice site probably null
R8338:Fbxl17 UTSW 17 63356758 missense possibly damaging 0.93
R8873:Fbxl17 UTSW 17 63384976 missense probably damaging 0.99
R9113:Fbxl17 UTSW 17 63225090 missense probably benign 0.09
X0019:Fbxl17 UTSW 17 63060383 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCGCTAAGCTCTTCTCTGGACAC -3'
(R):5'- TAGGCACTTCCTGTCACATGTCGC -3'

Sequencing Primer
(F):5'- CGCGCCTAAAACATTACAGTGG -3'
(R):5'- GCCCGCTCATATATTCATCATAG -3'
Posted On 2013-06-11