Incidental Mutation 'IGL03147:Ano3'
ID 453103
Institutional Source Beutler Lab
Gene Symbol Ano3
Ensembl Gene ENSMUSG00000074968
Gene Name anoctamin 3
Synonyms Tmem16c, B230324K02Rik
Accession Numbers

Genbank: NM_001081556, NM_001128103; MGI: 3613666

Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock # IGL03147 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 110655201-110950923 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 110697418 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 552 (S552P)
Ref Sequence ENSEMBL: ENSMUSP00000097219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099623]
AlphaFold A2AHL1
Predicted Effect probably damaging
Transcript: ENSMUST00000099623
AA Change: S552P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097219
Gene: ENSMUSG00000074968
AA Change: S552P

DomainStartEndE-ValueType
Pfam:Anoct_dimer 156 381 2.9e-70 PFAM
Pfam:Anoctamin 384 950 4.4e-138 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000111019
SMART Domains Protein: ENSMUSP00000106648
Gene: ENSMUSG00000074968

DomainStartEndE-ValueType
Pfam:Anoctamin 384 627 6.3e-60 PFAM
Meta Mutation Damage Score 0.3199 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 91% (39/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the TMEM16 family of predicted membrane proteins, that are also known as anoctamins. While little is known about the function of this gene, mutations in this gene have been associated with some cases of autosomal dominant craniocervical dystonia. Cells from individuals with a mutation in this gene exhibited abnormalities in endoplasmic reticulum-dependent calcium signaling. Studies in rat show that the rat ortholog of this protein interacts with, and modulates the activity of a sodium-activated potassium channel. Deletion of this gene caused increased pain sensitivity in the rat model system. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,169,229 probably benign Het
4631405K08Rik T A 1: 193,507,460 noncoding transcript Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Acan A G 7: 79,091,056 E390G probably damaging Het
Ccser1 A G 6: 61,312,160 S436G probably benign Het
Chek2 A G 5: 110,848,670 D166G probably damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Crb1 CG C 1: 139,237,086 probably null Het
Deup1 A T 9: 15,610,614 M85K probably damaging Het
Exo1 A G 1: 175,888,788 Y157C probably damaging Het
Ext1 T A 15: 53,088,072 I539F probably damaging Het
Gcn1l1 T C 5: 115,610,858 V1849A possibly damaging Het
Gpr161 A G 1: 165,317,308 T389A probably benign Het
Hjurp TGGG TTGCGGG 1: 88,266,280 probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Ncoa1 T A 12: 4,259,342 Y1318F probably damaging Het
Olfr1225 A G 2: 89,170,972 M80T probably benign Het
Pml T C 9: 58,230,043 H491R possibly damaging Het
Rbmxl2 T G 7: 107,209,651 S48A probably benign Het
Rgs6 A G 12: 83,091,846 D318G probably damaging Het
Sfi1 G A 11: 3,186,080 T84I possibly damaging Het
Slc2a2 A G 3: 28,719,370 M275V possibly damaging Het
Sp110 GC GCC 1: 85,591,567 probably null Het
Specc1 T C 11: 62,118,282 V288A probably benign Het
Speer4c A C 5: 15,714,216 probably benign Het
Srsf11 C T 3: 158,026,740 V118I probably damaging Het
St8sia2 C A 7: 73,966,819 C136F probably damaging Het
Stmn3 A T 2: 181,309,200 I21N possibly damaging Het
Trak2 G A 1: 58,910,063 T526M probably benign Het
Ttn T A 2: 76,711,967 K25231N probably damaging Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Vmn1r11 A T 6: 57,137,665 I68F probably damaging Het
Wdr92 G A 11: 17,229,845 G282E probably damaging Het
Zfr T A 15: 12,140,552 Y228* probably null Het
Other mutations in Ano3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Ano3 APN 2 110771050 splice site probably benign
IGL01066:Ano3 APN 2 110661445 missense probably null 0.00
IGL01696:Ano3 APN 2 110667737 missense probably damaging 1.00
IGL01729:Ano3 APN 2 110781394 splice site probably null
IGL01785:Ano3 APN 2 110682715 missense probably damaging 1.00
IGL01786:Ano3 APN 2 110682715 missense probably damaging 1.00
IGL01992:Ano3 APN 2 110658219 missense probably damaging 1.00
IGL02098:Ano3 APN 2 110666441 nonsense probably null
IGL02333:Ano3 APN 2 110697199 splice site probably benign
IGL02346:Ano3 APN 2 110770926 splice site probably benign
IGL02352:Ano3 APN 2 110884943 nonsense probably null
IGL02359:Ano3 APN 2 110884943 nonsense probably null
IGL02544:Ano3 APN 2 110658249 missense possibly damaging 0.79
IGL02750:Ano3 APN 2 110665984 splice site probably benign
IGL02861:Ano3 APN 2 110738812 missense probably damaging 1.00
IGL02948:Ano3 APN 2 110697018 splice site probably benign
IGL03327:Ano3 APN 2 110697178 missense possibly damaging 0.62
3-1:Ano3 UTSW 2 110697124 missense probably damaging 1.00
IGL02988:Ano3 UTSW 2 110775010 missense probably damaging 1.00
R0349:Ano3 UTSW 2 110661487 missense probably damaging 1.00
R0426:Ano3 UTSW 2 110661174 missense probably damaging 1.00
R0523:Ano3 UTSW 2 110884855 missense probably benign 0.13
R0557:Ano3 UTSW 2 110862952 splice site probably null
R0611:Ano3 UTSW 2 110885001 missense possibly damaging 0.93
R0891:Ano3 UTSW 2 110697976 missense probably benign 0.03
R1459:Ano3 UTSW 2 110880829 missense probably benign 0.00
R1460:Ano3 UTSW 2 110682758 missense probably damaging 0.97
R1773:Ano3 UTSW 2 110761455 missense probably damaging 1.00
R1874:Ano3 UTSW 2 110884872 missense probably benign 0.00
R1919:Ano3 UTSW 2 110885007 missense probably benign
R2185:Ano3 UTSW 2 110775045 missense probably benign 0.01
R2280:Ano3 UTSW 2 110682759 missense probably benign 0.22
R2281:Ano3 UTSW 2 110682759 missense probably benign 0.22
R2348:Ano3 UTSW 2 110783743 missense possibly damaging 0.82
R2425:Ano3 UTSW 2 110862843 missense probably benign
R2697:Ano3 UTSW 2 110794960 missense possibly damaging 0.79
R3888:Ano3 UTSW 2 110885000 missense probably damaging 0.99
R3923:Ano3 UTSW 2 110770959 missense probably damaging 1.00
R4352:Ano3 UTSW 2 110745894 missense possibly damaging 0.74
R4447:Ano3 UTSW 2 110761578 splice site probably null
R4790:Ano3 UTSW 2 110884919 missense probably benign
R4832:Ano3 UTSW 2 110667722 missense probably damaging 1.00
R4916:Ano3 UTSW 2 110771020 missense possibly damaging 0.74
R5113:Ano3 UTSW 2 110661480 missense possibly damaging 0.61
R5486:Ano3 UTSW 2 110745870 missense probably damaging 1.00
R5498:Ano3 UTSW 2 110697103 missense possibly damaging 0.68
R5589:Ano3 UTSW 2 110884995 missense probably damaging 0.99
R5627:Ano3 UTSW 2 110756953 missense possibly damaging 0.61
R5741:Ano3 UTSW 2 110658273 missense probably benign 0.11
R5767:Ano3 UTSW 2 110661271 missense probably damaging 1.00
R5883:Ano3 UTSW 2 110880864 missense probably null 0.15
R5899:Ano3 UTSW 2 110862887 missense probably benign 0.39
R5916:Ano3 UTSW 2 110681836 missense probably benign 0.29
R6158:Ano3 UTSW 2 110665875 missense probably damaging 1.00
R6315:Ano3 UTSW 2 110697039 missense probably damaging 1.00
R6401:Ano3 UTSW 2 110775114 missense probably benign 0.01
R6481:Ano3 UTSW 2 110795027 missense probably benign 0.16
R6482:Ano3 UTSW 2 110697055 missense probably damaging 1.00
R6587:Ano3 UTSW 2 110797904 splice site probably null
R6811:Ano3 UTSW 2 110880867 missense probably benign 0.03
R7048:Ano3 UTSW 2 110682771 nonsense probably null
R7145:Ano3 UTSW 2 110862860 missense probably benign 0.31
R7207:Ano3 UTSW 2 110781423 missense probably damaging 0.96
R7215:Ano3 UTSW 2 110665932 missense probably damaging 1.00
R7366:Ano3 UTSW 2 110757067 missense probably damaging 1.00
R7371:Ano3 UTSW 2 110884849 critical splice donor site probably null
R7568:Ano3 UTSW 2 110950293 start gained probably benign
R7636:Ano3 UTSW 2 110682703 nonsense probably null
R7888:Ano3 UTSW 2 110666428 missense probably damaging 1.00
R7992:Ano3 UTSW 2 110775022 missense possibly damaging 0.77
R8024:Ano3 UTSW 2 110667783 missense probably damaging 0.99
R8074:Ano3 UTSW 2 110950232 start gained probably benign
R8111:Ano3 UTSW 2 110783713 missense possibly damaging 0.95
R8177:Ano3 UTSW 2 110666456 missense probably damaging 1.00
R8297:Ano3 UTSW 2 110661271 missense probably damaging 1.00
R8485:Ano3 UTSW 2 110667855 critical splice acceptor site probably null
R8509:Ano3 UTSW 2 110665835 missense possibly damaging 0.50
R8870:Ano3 UTSW 2 110783729 missense probably benign 0.12
R9071:Ano3 UTSW 2 110795073 critical splice acceptor site probably null
R9072:Ano3 UTSW 2 110745898 missense probably benign 0.06
R9073:Ano3 UTSW 2 110745898 missense probably benign 0.06
R9315:Ano3 UTSW 2 110697942 missense probably damaging 0.97
R9376:Ano3 UTSW 2 110666437 missense probably damaging 1.00
R9588:Ano3 UTSW 2 110697997 missense possibly damaging 0.91
RF012:Ano3 UTSW 2 110697523 missense possibly damaging 0.83
RF013:Ano3 UTSW 2 110697036 missense probably benign 0.30
X0058:Ano3 UTSW 2 110697418 missense probably damaging 1.00
Z1088:Ano3 UTSW 2 110745847 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGAACACTGCTGTGATGACC -3'
(R):5'- TGTGCAAACAACACAACAGTGG -3'

Sequencing Primer
(F):5'- GCAAACAGGCCTTTTGTGTTAC -3'
(R):5'- CAACACAACAGTGGGATGAAGTC -3'
Posted On 2017-01-27