Incidental Mutation 'IGL03147:Stmn3'
ID 453104
Institutional Source Beutler Lab
Gene Symbol Stmn3
Ensembl Gene ENSMUSG00000027581
Gene Name stathmin-like 3
Synonyms Sclip, 9330161A03Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.316) question?
Stock # IGL03147 (G1)
Quality Score 128
Status Validated
Chromosome 2
Chromosomal Location 181306459-181314500 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 181309200 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 21 (I21N)
Ref Sequence ENSEMBL: ENSMUSP00000099334 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103045]
AlphaFold O70166
Predicted Effect possibly damaging
Transcript: ENSMUST00000103045
AA Change: I21N

PolyPhen 2 Score 0.634 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099334
Gene: ENSMUSG00000027581
AA Change: I21N

DomainStartEndE-ValueType
Pfam:Stathmin 41 175 2.7e-56 PFAM
Meta Mutation Damage Score 0.5628 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 91% (39/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is a member of the stathmin protein family. Members of this protein family form a complex with tubulins at a ratio of 2 tubulins for each stathmin protein. Microtubules require the ordered assembly of alpha- and beta-tubulins, and formation of a complex with stathmin disrupts microtubule formation and function. A pseudogene of this gene is located on chromosome 22. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,169,229 probably benign Het
4631405K08Rik T A 1: 193,507,460 noncoding transcript Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Acan A G 7: 79,091,056 E390G probably damaging Het
Ano3 A G 2: 110,697,418 S552P probably damaging Het
Ccser1 A G 6: 61,312,160 S436G probably benign Het
Chek2 A G 5: 110,848,670 D166G probably damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Crb1 CG C 1: 139,237,086 probably null Het
Deup1 A T 9: 15,610,614 M85K probably damaging Het
Exo1 A G 1: 175,888,788 Y157C probably damaging Het
Ext1 T A 15: 53,088,072 I539F probably damaging Het
Gcn1l1 T C 5: 115,610,858 V1849A possibly damaging Het
Gpr161 A G 1: 165,317,308 T389A probably benign Het
Hjurp TGGG TTGCGGG 1: 88,266,280 probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Ncoa1 T A 12: 4,259,342 Y1318F probably damaging Het
Olfr1225 A G 2: 89,170,972 M80T probably benign Het
Pml T C 9: 58,230,043 H491R possibly damaging Het
Rbmxl2 T G 7: 107,209,651 S48A probably benign Het
Rgs6 A G 12: 83,091,846 D318G probably damaging Het
Sfi1 G A 11: 3,186,080 T84I possibly damaging Het
Slc2a2 A G 3: 28,719,370 M275V possibly damaging Het
Sp110 GC GCC 1: 85,591,567 probably null Het
Specc1 T C 11: 62,118,282 V288A probably benign Het
Speer4c A C 5: 15,714,216 probably benign Het
Srsf11 C T 3: 158,026,740 V118I probably damaging Het
St8sia2 C A 7: 73,966,819 C136F probably damaging Het
Trak2 G A 1: 58,910,063 T526M probably benign Het
Ttn T A 2: 76,711,967 K25231N probably damaging Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Vmn1r11 A T 6: 57,137,665 I68F probably damaging Het
Wdr92 G A 11: 17,229,845 G282E probably damaging Het
Zfr T A 15: 12,140,552 Y228* probably null Het
Other mutations in Stmn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
Translucent UTSW 2 181308780 missense possibly damaging 0.81
R1916:Stmn3 UTSW 2 181307280 missense possibly damaging 0.86
R4113:Stmn3 UTSW 2 181307296 missense possibly damaging 0.87
R4391:Stmn3 UTSW 2 181308783 missense probably benign 0.11
R4910:Stmn3 UTSW 2 181308837 missense probably damaging 0.99
R5903:Stmn3 UTSW 2 181308780 missense possibly damaging 0.81
R6047:Stmn3 UTSW 2 181309159 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CTCCCAGAATGACTCTCTCCAG -3'
(R):5'- GGACAGAGACCCTGACTGAA -3'

Sequencing Primer
(F):5'- GCCAGTTCACAGCATTGC -3'
(R):5'- CTGATGTACATGACGAGTTCCAG -3'
Posted On 2017-01-27