Incidental Mutation 'IGL03147:St8sia2'
ID 453114
Institutional Source Beutler Lab
Gene Symbol St8sia2
Ensembl Gene ENSMUSG00000025789
Gene Name ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 2
Synonyms Siat8b, ST8SiaII
Accession Numbers

Ncbi RefSeq: NM_009181.2; MGI:106020

Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock # IGL03147 (G1)
Quality Score 207
Status Validated
Chromosome 7
Chromosomal Location 73939119-74013690 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 73966819 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 136 (C136F)
Ref Sequence ENSEMBL: ENSMUSP00000141307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026896] [ENSMUST00000191970]
AlphaFold O35696
Predicted Effect probably damaging
Transcript: ENSMUST00000026896
AA Change: C157F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026896
Gene: ENSMUSG00000025789
AA Change: C157F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 25 39 N/A INTRINSIC
Pfam:Glyco_transf_29 109 369 2.7e-72 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000191970
AA Change: C136F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141307
Gene: ENSMUSG00000025789
AA Change: C136F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 25 38 N/A INTRINSIC
Pfam:Glyco_transf_29 84 206 5.8e-36 PFAM
Meta Mutation Damage Score 0.9614 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 91% (39/43)
MGI Phenotype Strain: 3051219
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type II membrane protein that is thought to catalyze the transfer of sialic acid from CMP-sialic acid to N-linked oligosaccharides and glycoproteins. The encoded protein may be found in the Golgi apparatus and may be involved in the production of polysialic acid, a modulator of the adhesive properties of neural cell adhesion molecule (NCAM1). This protein is a member of glycosyltransferase family 29. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display abnormal mossy fiber morphology, increased exploration in new environment and impaired fear responses. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,169,229 probably benign Het
4631405K08Rik T A 1: 193,507,460 noncoding transcript Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Acan A G 7: 79,091,056 E390G probably damaging Het
Ano3 A G 2: 110,697,418 S552P probably damaging Het
Ccser1 A G 6: 61,312,160 S436G probably benign Het
Chek2 A G 5: 110,848,670 D166G probably damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Crb1 CG C 1: 139,237,086 probably null Het
Deup1 A T 9: 15,610,614 M85K probably damaging Het
Exo1 A G 1: 175,888,788 Y157C probably damaging Het
Ext1 T A 15: 53,088,072 I539F probably damaging Het
Gcn1l1 T C 5: 115,610,858 V1849A possibly damaging Het
Gpr161 A G 1: 165,317,308 T389A probably benign Het
Hjurp TGGG TTGCGGG 1: 88,266,280 probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Ncoa1 T A 12: 4,259,342 Y1318F probably damaging Het
Olfr1225 A G 2: 89,170,972 M80T probably benign Het
Pml T C 9: 58,230,043 H491R possibly damaging Het
Rbmxl2 T G 7: 107,209,651 S48A probably benign Het
Rgs6 A G 12: 83,091,846 D318G probably damaging Het
Sfi1 G A 11: 3,186,080 T84I possibly damaging Het
Slc2a2 A G 3: 28,719,370 M275V possibly damaging Het
Sp110 GC GCC 1: 85,591,567 probably null Het
Specc1 T C 11: 62,118,282 V288A probably benign Het
Speer4c A C 5: 15,714,216 probably benign Het
Srsf11 C T 3: 158,026,740 V118I probably damaging Het
Stmn3 A T 2: 181,309,200 I21N possibly damaging Het
Trak2 G A 1: 58,910,063 T526M probably benign Het
Ttn T A 2: 76,711,967 K25231N probably damaging Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Vmn1r11 A T 6: 57,137,665 I68F probably damaging Het
Wdr92 G A 11: 17,229,845 G282E probably damaging Het
Zfr T A 15: 12,140,552 Y228* probably null Het
Other mutations in St8sia2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02161:St8sia2 APN 7 73976682 missense probably benign 0.00
IGL02261:St8sia2 APN 7 73966846 missense probably damaging 1.00
IGL02941:St8sia2 APN 7 73976649 intron probably benign
IGL02971:St8sia2 APN 7 73966811 missense probably damaging 1.00
BB001:St8sia2 UTSW 7 73966952 missense probably damaging 1.00
BB011:St8sia2 UTSW 7 73966952 missense probably damaging 1.00
R0052:St8sia2 UTSW 7 73943290 nonsense probably null
R0052:St8sia2 UTSW 7 73943290 nonsense probably null
R0052:St8sia2 UTSW 7 73971952 missense probably damaging 1.00
R0733:St8sia2 UTSW 7 73960840 missense probably benign
R1202:St8sia2 UTSW 7 73972035 missense probably benign 0.43
R1419:St8sia2 UTSW 7 73966994 nonsense probably null
R1962:St8sia2 UTSW 7 73943309 missense probably damaging 1.00
R2051:St8sia2 UTSW 7 73943202 missense possibly damaging 0.91
R4106:St8sia2 UTSW 7 73960761 missense probably damaging 1.00
R4989:St8sia2 UTSW 7 73966961 missense possibly damaging 0.75
R5541:St8sia2 UTSW 7 73966900 missense probably benign 0.00
R5859:St8sia2 UTSW 7 73966906 missense probably damaging 1.00
R6029:St8sia2 UTSW 7 73960710 missense possibly damaging 0.96
R6260:St8sia2 UTSW 7 73976693 missense possibly damaging 0.56
R6416:St8sia2 UTSW 7 73971921 missense probably damaging 1.00
R7371:St8sia2 UTSW 7 73966927 missense probably damaging 0.99
R7424:St8sia2 UTSW 7 73960902 missense possibly damaging 0.66
R7763:St8sia2 UTSW 7 73943321 missense probably damaging 1.00
R7924:St8sia2 UTSW 7 73966952 missense probably damaging 1.00
R8688:St8sia2 UTSW 7 73943344 missense probably damaging 1.00
R9137:St8sia2 UTSW 7 73960906 missense probably benign 0.03
R9139:St8sia2 UTSW 7 73966765 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTTGAGAACAGAATGTACCC -3'
(R):5'- GAGCCAGTACACAGCATCTAG -3'

Sequencing Primer
(F):5'- CAATTAATGGGGCTTGTTTCAGCC -3'
(R):5'- GCATCTAGCAGCATGGAGACTTTC -3'
Posted On 2017-01-27