Incidental Mutation 'IGL03147:Deup1'
ID 453119
Institutional Source Beutler Lab
Gene Symbol Deup1
Ensembl Gene ENSMUSG00000039977
Gene Name deuterosome assembly protein 1
Synonyms Ccdc67, 4933401K09Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # IGL03147 (G1)
Quality Score 145
Status Validated
Chromosome 9
Chromosomal Location 15559864-15627933 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 15610614 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 85 (M85K)
Ref Sequence ENSEMBL: ENSMUSP00000111256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045513] [ENSMUST00000115592] [ENSMUST00000115593] [ENSMUST00000152377]
AlphaFold Q7M6Y5
Predicted Effect probably damaging
Transcript: ENSMUST00000045513
AA Change: M85K

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000039912
Gene: ENSMUSG00000039977
AA Change: M85K

DomainStartEndE-ValueType
Pfam:CEP63 11 279 7.7e-92 PFAM
low complexity region 286 299 N/A INTRINSIC
coiled coil region 353 397 N/A INTRINSIC
coiled coil region 555 586 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115592
AA Change: M85K

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111255
Gene: ENSMUSG00000039977
AA Change: M85K

DomainStartEndE-ValueType
coiled coil region 29 59 N/A INTRINSIC
coiled coil region 166 196 N/A INTRINSIC
coiled coil region 226 277 N/A INTRINSIC
low complexity region 286 299 N/A INTRINSIC
coiled coil region 461 492 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115593
AA Change: M85K

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111256
Gene: ENSMUSG00000039977
AA Change: M85K

DomainStartEndE-ValueType
coiled coil region 29 59 N/A INTRINSIC
coiled coil region 166 196 N/A INTRINSIC
coiled coil region 226 277 N/A INTRINSIC
low complexity region 286 299 N/A INTRINSIC
coiled coil region 461 492 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152377
AA Change: M85K

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000121526
Gene: ENSMUSG00000039977
AA Change: M85K

DomainStartEndE-ValueType
coiled coil region 29 59 N/A INTRINSIC
coiled coil region 166 196 N/A INTRINSIC
coiled coil region 226 277 N/A INTRINSIC
low complexity region 286 299 N/A INTRINSIC
coiled coil region 353 397 N/A INTRINSIC
Meta Mutation Damage Score 0.2452 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 91% (39/43)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,169,229 probably benign Het
4631405K08Rik T A 1: 193,507,460 noncoding transcript Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Acan A G 7: 79,091,056 E390G probably damaging Het
Ano3 A G 2: 110,697,418 S552P probably damaging Het
Ccser1 A G 6: 61,312,160 S436G probably benign Het
Chek2 A G 5: 110,848,670 D166G probably damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Crb1 CG C 1: 139,237,086 probably null Het
Exo1 A G 1: 175,888,788 Y157C probably damaging Het
Ext1 T A 15: 53,088,072 I539F probably damaging Het
Gcn1l1 T C 5: 115,610,858 V1849A possibly damaging Het
Gpr161 A G 1: 165,317,308 T389A probably benign Het
Hjurp TGGG TTGCGGG 1: 88,266,280 probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Ncoa1 T A 12: 4,259,342 Y1318F probably damaging Het
Olfr1225 A G 2: 89,170,972 M80T probably benign Het
Pml T C 9: 58,230,043 H491R possibly damaging Het
Rbmxl2 T G 7: 107,209,651 S48A probably benign Het
Rgs6 A G 12: 83,091,846 D318G probably damaging Het
Sfi1 G A 11: 3,186,080 T84I possibly damaging Het
Slc2a2 A G 3: 28,719,370 M275V possibly damaging Het
Sp110 GC GCC 1: 85,591,567 probably null Het
Specc1 T C 11: 62,118,282 V288A probably benign Het
Speer4c A C 5: 15,714,216 probably benign Het
Srsf11 C T 3: 158,026,740 V118I probably damaging Het
St8sia2 C A 7: 73,966,819 C136F probably damaging Het
Stmn3 A T 2: 181,309,200 I21N possibly damaging Het
Trak2 G A 1: 58,910,063 T526M probably benign Het
Ttn T A 2: 76,711,967 K25231N probably damaging Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Vmn1r11 A T 6: 57,137,665 I68F probably damaging Het
Wdr92 G A 11: 17,229,845 G282E probably damaging Het
Zfr T A 15: 12,140,552 Y228* probably null Het
Other mutations in Deup1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Deup1 APN 9 15561370 missense probably damaging 0.96
IGL00927:Deup1 APN 9 15610671 splice site probably benign
IGL00946:Deup1 APN 9 15561238 missense possibly damaging 0.62
IGL02458:Deup1 APN 9 15592360 missense probably benign 0.02
IGL02567:Deup1 APN 9 15575283 missense probably damaging 1.00
IGL03089:Deup1 APN 9 15607800 missense possibly damaging 0.62
IGL03220:Deup1 APN 9 15592411 missense probably benign 0.38
PIT4468001:Deup1 UTSW 9 15564005 missense possibly damaging 0.79
R0035:Deup1 UTSW 9 15599821 missense possibly damaging 0.89
R0035:Deup1 UTSW 9 15599821 missense possibly damaging 0.89
R0324:Deup1 UTSW 9 15582533 missense probably benign 0.01
R0539:Deup1 UTSW 9 15582597 missense possibly damaging 0.51
R0835:Deup1 UTSW 9 15599751 missense probably damaging 1.00
R1666:Deup1 UTSW 9 15575191 missense possibly damaging 0.92
R2212:Deup1 UTSW 9 15599843 missense probably benign 0.00
R2237:Deup1 UTSW 9 15575301 missense probably damaging 1.00
R2238:Deup1 UTSW 9 15575301 missense probably damaging 1.00
R2423:Deup1 UTSW 9 15592458 nonsense probably null
R2929:Deup1 UTSW 9 15575188 missense probably benign 0.03
R3890:Deup1 UTSW 9 15599713 missense probably damaging 1.00
R3892:Deup1 UTSW 9 15599713 missense probably damaging 1.00
R4941:Deup1 UTSW 9 15588027 missense probably benign
R4959:Deup1 UTSW 9 15612014 nonsense probably null
R4960:Deup1 UTSW 9 15600968 missense possibly damaging 0.87
R4968:Deup1 UTSW 9 15592428 missense probably damaging 0.99
R4973:Deup1 UTSW 9 15612014 nonsense probably null
R5195:Deup1 UTSW 9 15575191 missense possibly damaging 0.92
R5231:Deup1 UTSW 9 15575199 missense probably damaging 0.96
R5470:Deup1 UTSW 9 15582620 splice site probably null
R5931:Deup1 UTSW 9 15561322 missense possibly damaging 0.55
R6049:Deup1 UTSW 9 15561256 missense possibly damaging 0.75
R6373:Deup1 UTSW 9 15561342 missense probably damaging 0.99
R6516:Deup1 UTSW 9 15610614 missense probably damaging 0.99
R7948:Deup1 UTSW 9 15610648 missense possibly damaging 0.76
R8373:Deup1 UTSW 9 15592375 missense possibly damaging 0.80
R8725:Deup1 UTSW 9 15592425 missense probably damaging 1.00
R9008:Deup1 UTSW 9 15599844 missense probably damaging 0.99
R9462:Deup1 UTSW 9 15582586 missense probably benign 0.04
R9545:Deup1 UTSW 9 15607824 missense possibly damaging 0.95
Z1177:Deup1 UTSW 9 15600903 missense probably null 1.00
Z1177:Deup1 UTSW 9 15607832 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- AGGCAGTGCAGATGCTATC -3'
(R):5'- ACGACAAACATTTGCCCTTGG -3'

Sequencing Primer
(F):5'- ACCCATGAGATAGTGAAAGTCTG -3'
(R):5'- TTGGCTCTGTGCAGCGC -3'
Posted On 2017-01-27