Incidental Mutation 'R0554:Pdcd1'
ID45313
Institutional Source Beutler Lab
Gene Symbol Pdcd1
Ensembl Gene ENSMUSG00000026285
Gene Nameprogrammed cell death 1
SynonymsPD-1, Pdc1
MMRRC Submission 038746-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R0554 (G1)
Quality Score212
Status Not validated
Chromosome1
Chromosomal Location94038305-94052553 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 94039382 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 264 (R264C)
Ref Sequence ENSEMBL: ENSMUSP00000027507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027507]
PDB Structure
CRYSTAL STRUCTURE OF THE EXTRACELLULAR DOMAIN OF MURINE PD-1 [X-RAY DIFFRACTION]
Crystal Structure of the PD-1/PD-L1 Complex [X-RAY DIFFRACTION]
Crystal structure of the mouse PD-1 and PD-L2 complex [X-RAY DIFFRACTION]
Crystal structure of the mouse PD-1 Mutant and PD-L2 complex [X-RAY DIFFRACTION]
Crystal structure of the complex between mouse PD-1 mutant and PD-L2 IgV domain [X-RAY DIFFRACTION]
Crystal structure of the complex between the extracellular domains of mouse PD-1 mutant and PD-L2 [X-RAY DIFFRACTION]
Crystal structure of the complex between the extracellular domains of mouse PD-1 mutant and human PD-L1 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000027507
AA Change: R264C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027507
Gene: ENSMUSG00000026285
AA Change: R264C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 39 145 3.33e-9 SMART
transmembrane domain 170 192 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface membrane protein of the immunoglobulin superfamily. This protein is expressed in pro-B-cells and is thought to play a role in their differentiation. In mice, expression of this gene is induced in the thymus when anti-CD3 antibodies are injected and large numbers of thymocytes undergo apoptosis. Mice deficient for this gene bred on a BALB/c background developed dilated cardiomyopathy and died from congestive heart failure. These studies suggest that this gene product may also be important in T cell function and contribute to the prevention of autoimmune diseases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormalities in leukopoiesis and the immune system which vary considerably depending on the genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T A 5: 145,045,371 Y255* probably null Het
1810024B03Rik A G 2: 127,187,276 M1T probably null Het
4930503L19Rik T C 18: 70,467,380 D386G probably damaging Het
Ace2 T A X: 164,175,951 N601K probably benign Het
Adam4 A C 12: 81,421,424 I141R probably damaging Het
Adcy10 G A 1: 165,513,130 G235S probably benign Het
Adcy5 G A 16: 35,294,017 V997I probably benign Het
Aff2 T G X: 69,864,074 W1221G possibly damaging Het
Ankrd44 T C 1: 54,763,758 N194D probably benign Het
Apba2 T G 7: 64,745,780 L668R probably damaging Het
Asph T C 4: 9,604,581 D152G probably damaging Het
Bcl3 C G 7: 19,820,066 V126L probably benign Het
Cd163 A G 6: 124,312,660 T446A probably benign Het
Cd209g C T 8: 4,134,995 probably benign Het
Cdadc1 A T 14: 59,586,452 V197E probably damaging Het
CN725425 T C 15: 91,260,763 C610R possibly damaging Het
Col6a2 A G 10: 76,611,161 probably null Het
Coro7 A G 16: 4,632,257 L576P possibly damaging Het
Dgkb T A 12: 38,216,031 V503E probably benign Het
Dhx57 A T 17: 80,260,236 L806* probably null Het
Dlec1 T C 9: 119,115,002 V373A probably benign Het
Dnah11 G T 12: 117,931,178 R3645S probably benign Het
Dnhd1 T C 7: 105,694,395 S1649P probably benign Het
Draxin T G 4: 148,107,963 K297N probably damaging Het
Epha7 T C 4: 28,951,401 S841P probably damaging Het
Esp8 T G 17: 40,530,275 D142E unknown Het
F5 T G 1: 164,179,449 V274G probably damaging Het
Fancc T C 13: 63,317,469 S475G probably benign Het
Fmo3 T C 1: 162,954,332 N484S probably benign Het
Focad T C 4: 88,348,889 Y1046H unknown Het
Furin C T 7: 80,391,284 G602D probably damaging Het
Fut8 A T 12: 77,364,970 I69L probably benign Het
Gm10436 T C 12: 88,177,558 T162A probably benign Het
Gm4951 G A 18: 60,245,417 R8H probably benign Het
Gnai3 A G 3: 108,123,612 I78T probably benign Het
Gpr182 T C 10: 127,751,071 I4V probably benign Het
Gpr63 T C 4: 25,007,447 M57T probably benign Het
Grm1 T A 10: 10,719,923 T654S probably benign Het
Gtf2h4 T C 17: 35,668,639 T371A probably benign Het
Helq T C 5: 100,790,200 N460S probably benign Het
Hmcn1 T C 1: 150,719,117 N1867S probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Inpp5j A G 11: 3,499,644 Y713H probably damaging Het
Ints6 A T 14: 62,704,751 V511D possibly damaging Het
Itga4 A G 2: 79,279,117 Y220C probably damaging Het
Itgav T G 2: 83,794,270 S735A possibly damaging Het
Kctd16 A G 18: 40,258,439 I27V probably benign Het
Klhl6 T C 16: 19,953,593 E334G probably damaging Het
Lrmp G A 6: 145,165,287 A237T probably benign Het
Ltbp1 T A 17: 75,225,279 L116H probably damaging Het
Magohb T A 6: 131,285,697 H98L probably benign Het
Mgat2 A G 12: 69,185,392 T247A probably benign Het
Mtif2 G A 11: 29,533,398 probably null Het
Myrfl T C 10: 116,828,973 E384G probably damaging Het
Nfam1 G T 15: 83,033,209 R8S probably benign Het
Numa1 T C 7: 101,995,524 S236P possibly damaging Het
Olfr1022 T C 2: 85,869,519 F309S probably benign Het
Olfr310 A T 7: 86,269,657 I44N probably damaging Het
Olfr317 T C 11: 58,733,039 N42S probably damaging Het
Olfr777 T C 10: 129,268,499 T275A probably benign Het
Orc4 C T 2: 48,905,421 S431N probably benign Het
Pax2 T C 19: 44,761,861 V129A probably damaging Het
Pcdhb15 A G 18: 37,474,519 D268G probably damaging Het
Pi15 T A 1: 17,621,648 M187K probably benign Het
Plag1 C T 4: 3,904,546 C215Y probably damaging Het
Plagl1 A G 10: 13,127,182 T65A probably benign Het
Prss48 T A 3: 86,000,921 Q18L probably benign Het
Prune2 T A 19: 17,125,218 C2580* probably null Het
Rab40b T A 11: 121,359,606 Q74L probably damaging Het
Raf1 A G 6: 115,623,530 I376T probably benign Het
Rbm46 A T 3: 82,865,268 F186I probably damaging Het
Reps1 C T 10: 18,123,119 T720M possibly damaging Het
Rgs22 A G 15: 36,054,709 M649T probably benign Het
Rhot1 C T 11: 80,243,438 R47* probably null Het
Rhox2f A G X: 37,571,471 Y8C possibly damaging Het
Rnf17 A G 14: 56,522,550 Y1604C probably damaging Het
Rnf40 T C 7: 127,602,584 C943R probably damaging Het
Ropn1l A T 15: 31,451,149 M63K probably benign Het
Sbf2 C A 7: 110,428,287 V501F probably damaging Het
Sh3bp1 T A 15: 78,907,267 M354K probably damaging Het
Sipa1l3 T C 7: 29,388,030 H590R possibly damaging Het
Slco6d1 T A 1: 98,466,697 C369S probably benign Het
Sulf1 T C 1: 12,805,194 Y143H probably damaging Het
Tiam2 A T 17: 3,438,681 R755* probably null Het
Trim12c C A 7: 104,344,962 L228F probably damaging Het
Ttc23l G T 15: 10,530,657 Q290K probably benign Het
Uba3 T C 6: 97,191,260 probably null Het
Ugt1a10 A G 1: 88,056,095 E205G probably damaging Het
Ugt3a2 T A 15: 9,351,120 S72T probably benign Het
Upk3bl C T 5: 136,059,794 T113I probably damaging Het
Uspl1 T A 5: 149,187,834 D20E probably damaging Het
Vmn2r19 G A 6: 123,336,143 G724E probably damaging Het
Vmn2r63 T A 7: 42,933,705 K29* probably null Het
Vwf C T 6: 125,642,781 A1474V probably benign Het
Xpc C T 6: 91,491,226 A860T probably benign Het
Zfp462 A G 4: 55,013,689 H737R probably damaging Het
Zfp536 T C 7: 37,480,819 D787G probably damaging Het
Zfp692 A G 11: 58,314,227 H434R probably damaging Het
Zp1 C A 19: 10,920,562 C5F probably benign Het
Other mutations in Pdcd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Pdcd1 APN 1 94040135 splice site probably benign
IGL01522:Pdcd1 APN 1 94040846 missense probably benign 0.00
IGL02337:Pdcd1 APN 1 94040857 missense probably benign 0.08
IGL02750:Pdcd1 APN 1 94039544 splice site probably benign
R6720_Pdcd1_520 UTSW 1 94041389 missense probably benign 0.00
R0092:Pdcd1 UTSW 1 94052424 missense possibly damaging 0.49
R0931:Pdcd1 UTSW 1 94039513 missense probably benign 0.05
R3932:Pdcd1 UTSW 1 94041264 missense probably benign 0.01
R5222:Pdcd1 UTSW 1 94052450 missense probably damaging 0.99
R5914:Pdcd1 UTSW 1 94040825 missense probably benign 0.15
R6186:Pdcd1 UTSW 1 94040121 nonsense probably null
R6720:Pdcd1 UTSW 1 94041389 missense probably benign 0.00
R6844:Pdcd1 UTSW 1 94039381 missense probably benign 0.36
R8233:Pdcd1 UTSW 1 94039417 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGTCTCAAGTCCCTAGAAGTGCC -3'
(R):5'- CTTGAAGAAGGAGGAGCCTTCAGC -3'

Sequencing Primer
(F):5'- ttaggccccagctctgc -3'
(R):5'- CAGCACCTGTCCCTAGTGTG -3'
Posted On2013-06-11