Incidental Mutation 'R4987:Serinc2'
ID453138
Institutional Source Beutler Lab
Gene Symbol Serinc2
Ensembl Gene ENSMUSG00000023232
Gene Nameserine incorporator 2
SynonymsFKSG84, 2310004K20Rik, TDE2, Tde2l
MMRRC Submission 042581-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R4987 (G1)
Quality Score23
Status Validated
Chromosome4
Chromosomal Location130253495-130279205 bp(-) (GRCm38)
Type of Mutationsplice site (1 bp from exon)
DNA Base Change (assembly) C to T at 130263027 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105996] [ENSMUST00000105996] [ENSMUST00000120126] [ENSMUST00000120126] [ENSMUST00000122374] [ENSMUST00000122374] [ENSMUST00000146478] [ENSMUST00000146478] [ENSMUST00000154846]
Predicted Effect probably null
Transcript: ENSMUST00000105996
SMART Domains Protein: ENSMUSP00000101618
Gene: ENSMUSG00000023232

DomainStartEndE-ValueType
Pfam:Serinc 15 449 4.1e-162 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000105996
SMART Domains Protein: ENSMUSP00000101618
Gene: ENSMUSG00000023232

DomainStartEndE-ValueType
Pfam:Serinc 15 449 4.1e-162 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000120126
SMART Domains Protein: ENSMUSP00000113044
Gene: ENSMUSG00000023232

DomainStartEndE-ValueType
Pfam:Serinc 25 457 1.4e-158 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000120126
SMART Domains Protein: ENSMUSP00000113044
Gene: ENSMUSG00000023232

DomainStartEndE-ValueType
Pfam:Serinc 25 457 1.4e-158 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000122374
SMART Domains Protein: ENSMUSP00000112535
Gene: ENSMUSG00000023232

DomainStartEndE-ValueType
Pfam:Serinc 1 394 2.9e-148 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000122374
SMART Domains Protein: ENSMUSP00000112535
Gene: ENSMUSG00000023232

DomainStartEndE-ValueType
Pfam:Serinc 1 394 2.9e-148 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000146478
SMART Domains Protein: ENSMUSP00000115198
Gene: ENSMUSG00000023232

DomainStartEndE-ValueType
Pfam:Serinc 1 148 1.9e-56 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000146478
SMART Domains Protein: ENSMUSP00000115198
Gene: ENSMUSG00000023232

DomainStartEndE-ValueType
Pfam:Serinc 1 148 1.9e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154846
SMART Domains Protein: ENSMUSP00000116586
Gene: ENSMUSG00000023232

DomainStartEndE-ValueType
Pfam:Serinc 1 82 3.3e-26 PFAM
Meta Mutation Damage Score 0.9489 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.3%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik T C 9: 92,354,584 S175P probably damaging Het
Acrbp T C 6: 125,053,762 S249P probably benign Het
Adcy4 A G 14: 55,773,477 V661A probably benign Het
Ahdc1 T G 4: 133,064,320 H957Q possibly damaging Het
Atp10b A G 11: 43,151,613 probably benign Het
B3gnt5 A T 16: 19,769,202 N57I probably damaging Het
BC067074 T C 13: 113,318,101 V227A probably benign Het
Brms1l T A 12: 55,866,015 D264E probably benign Het
Camk1g T A 1: 193,348,475 N309Y probably damaging Het
Chl1 A G 6: 103,674,977 T285A probably damaging Het
Dennd1c G T 17: 57,073,852 T200K probably damaging Het
Dpysl3 C A 18: 43,328,427 M566I probably benign Het
Dscam A T 16: 96,697,521 D985E probably benign Het
Fmo5 T C 3: 97,635,578 M68T probably benign Het
Gm26996 A G 6: 130,590,996 unknown Het
Gm9991 A T 1: 90,675,416 noncoding transcript Het
Gzmc T A 14: 56,231,540 I241L probably damaging Het
Hibadh A T 6: 52,622,895 S105R probably damaging Het
Krt83 A G 15: 101,487,009 I402T probably benign Het
Krtap31-2 A G 11: 99,936,570 D76G possibly damaging Het
Lin9 A G 1: 180,668,764 S249G probably damaging Het
Lpcat1 T A 13: 73,489,103 probably null Het
Mfap4 A G 11: 61,486,082 I46V probably benign Het
Nos1 T C 5: 117,926,533 probably null Het
Nostrin A G 2: 69,156,431 M107V probably benign Het
Nutm2 C T 13: 50,472,343 T322I possibly damaging Het
Olfr1080 A C 2: 86,553,235 D296E probably null Het
Pcdha12 T A 18: 37,021,551 V441E probably damaging Het
Plcd4 A G 1: 74,547,959 probably benign Het
Ppme1 T C 7: 100,345,071 D145G probably benign Het
Rbm25 T C 12: 83,677,856 V793A probably damaging Het
Rlbp1 A T 7: 79,380,131 V118E probably damaging Het
Slc25a32 A G 15: 39,100,019 C136R possibly damaging Het
Smco2 A G 6: 146,856,092 D48G possibly damaging Het
Trpv4 T C 5: 114,622,732 D846G probably benign Het
Ubr1 A T 2: 120,963,566 L46I probably benign Het
Wdsub1 A G 2: 59,870,393 probably benign Het
Zp3 T A 5: 135,987,505 C320* probably null Het
Other mutations in Serinc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Serinc2 APN 4 130264408 missense possibly damaging 0.88
IGL02031:Serinc2 APN 4 130264444 nonsense probably null
IGL02551:Serinc2 APN 4 130260774 missense probably benign 0.01
R1455:Serinc2 UTSW 4 130264340 missense probably damaging 0.96
R1520:Serinc2 UTSW 4 130260750 missense probably benign 0.00
R2059:Serinc2 UTSW 4 130260785 missense probably damaging 1.00
R2869:Serinc2 UTSW 4 130265212 missense probably damaging 1.00
R2869:Serinc2 UTSW 4 130265212 missense probably damaging 1.00
R3160:Serinc2 UTSW 4 130260735 missense probably benign
R3162:Serinc2 UTSW 4 130260735 missense probably benign
R4497:Serinc2 UTSW 4 130254054 missense possibly damaging 0.67
R4735:Serinc2 UTSW 4 130263645 missense probably benign 0.13
R5569:Serinc2 UTSW 4 130278479 missense probably benign 0.17
R5681:Serinc2 UTSW 4 130265076 missense probably damaging 1.00
R5946:Serinc2 UTSW 4 130255521 missense possibly damaging 0.91
R6556:Serinc2 UTSW 4 130258271 missense probably damaging 1.00
R6898:Serinc2 UTSW 4 130255442 missense probably benign 0.13
R7264:Serinc2 UTSW 4 130258259 missense probably benign 0.00
R7526:Serinc2 UTSW 4 130258790 missense probably benign 0.03
R7835:Serinc2 UTSW 4 130275487 missense unknown
Z1176:Serinc2 UTSW 4 130253995 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAAGAGCCTGGCCCATTCC -3'
(R):5'- TGACTGAAGCTATGCTGGGAAC -3'

Sequencing Primer
(F):5'- GGCCCATTCCCTGCTGTG -3'
(R):5'- TGCTGTCCCCATAGCCG -3'
Posted On2017-01-30