Incidental Mutation 'IGL03134:Pax8'
ID453145
Institutional Source Beutler Lab
Gene Symbol Pax8
Ensembl Gene ENSMUSG00000026976
Gene Namepaired box 8
SynonymsPax-8
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #IGL03134 (G1)
Quality Score119
Status Validated
Chromosome2
Chromosomal Location24420560-24475599 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 24421391 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134343 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028355] [ENSMUST00000149294] [ENSMUST00000153601]
Predicted Effect probably benign
Transcript: ENSMUST00000028355
SMART Domains Protein: ENSMUSP00000028355
Gene: ENSMUSG00000026976

DomainStartEndE-ValueType
PAX 9 133 3.1e-93 SMART
SCOP:d1ftt__ 221 247 8e-5 SMART
low complexity region 311 328 N/A INTRINSIC
Pfam:Pax2_C 344 456 2.3e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149294
SMART Domains Protein: ENSMUSP00000115194
Gene: ENSMUSG00000026976

DomainStartEndE-ValueType
PAX 9 133 3.1e-93 SMART
SCOP:d1ftt__ 221 247 3e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149860
Predicted Effect probably benign
Transcript: ENSMUST00000153601
SMART Domains Protein: ENSMUSP00000134343
Gene: ENSMUSG00000026976

DomainStartEndE-ValueType
SCOP:d1ftt__ 23 49 1e-4 SMART
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: This gene encodes a member of a family of transcription factors that contain a characteristic N-terminal paired DNA-binding domain. The encoded protein is important for proper differentiation of the thyroid and the kidney. Alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygotes for targeted mutations exhibit severe hypothyroidism due to thyroid follicular cell aplasia, male infertility, deafness, ataxia, growth retardation, tiny spleens, impaired ossification of long bones and maturation of the small intestine, fatty livers, and lethality around weaning age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414J04Rik A T 11: 21,507,249 noncoding transcript Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Afdn C T 17: 13,846,286 T580I probably benign Het
Ankfy1 G T 11: 72,712,185 L13F probably damaging Het
Arhgap12 T C 18: 6,111,936 T143A probably benign Het
Arsi T G 18: 60,917,352 W436G probably damaging Het
Bcl2l10 C T 9: 75,348,198 T99M probably damaging Het
C77080 A G 4: 129,222,487 S783P possibly damaging Het
Cacna1a A G 8: 84,559,087 Q740R probably damaging Het
Cacna1g A G 11: 94,459,825 F398S probably damaging Het
Ccrl2 A C 9: 111,055,657 Y258D probably damaging Het
Cemip T A 7: 83,999,237 D38V probably damaging Het
Chd6 C G 2: 160,965,483 C1937S possibly damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Col1a2 T G 6: 4,521,387 probably benign Het
Col4a1 T C 8: 11,240,069 probably null Het
Cops7b T A 1: 86,592,334 L69Q probably damaging Het
Crb1 CG C 1: 139,237,086 probably null Het
Ddx3y T A Y: 1,278,949 D163V possibly damaging Het
Dnajc19 A G 3: 34,078,735 probably benign Het
Fam160b2 T C 14: 70,588,709 T288A possibly damaging Het
G2e3 T A 12: 51,364,030 probably benign Het
Gimap7 A G 6: 48,723,501 N7S probably benign Het
Gkap1 G A 13: 58,263,932 probably benign Het
Gm3404 G A 5: 146,526,896 R117Q probably benign Het
Herc1 T TN 9: 66,434,063 probably benign Homo
Homer3 T C 8: 70,286,335 Y115H probably benign Het
Ighv10-1 T A 12: 114,479,069 M99L probably benign Het
Kdm2b A C 5: 122,932,674 S398R probably damaging Het
Lyl1 C T 8: 84,702,671 P3L possibly damaging Het
Mettl25 G A 10: 105,826,027 Q361* probably null Het
Mkrn2 T A 6: 115,613,535 I284N probably damaging Het
Mmp14 T A 14: 54,439,106 N369K probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Myo6 C G 9: 80,292,467 N1019K probably damaging Het
Myo7a C T 7: 98,056,767 V1857I probably damaging Het
Nktr T C 9: 121,746,466 S347P probably damaging Het
Nup210 T G 6: 91,030,190 D548A probably damaging Het
Nup210l A G 3: 90,190,887 Y1382C possibly damaging Het
Olfr295 G A 7: 86,586,012 V246M probably damaging Het
Olfr382 T A 11: 73,517,115 Y28F probably benign Het
Pcdhgb7 A G 18: 37,751,882 Y35C probably damaging Het
Pld1 A T 3: 28,029,167 R145S probably benign Het
Pom121 G A 5: 135,382,081 P741S unknown Het
Rarb T C 14: 16,436,910 N204D probably damaging Het
Sdc3 A G 4: 130,821,504 E337G probably benign Het
Serpina9 T C 12: 104,001,437 K233R probably null Het
Speer4c A C 5: 15,714,216 probably benign Het
Sspo T A 6: 48,451,065 M159K probably benign Het
Stxbp4 C A 11: 90,607,184 R96S probably damaging Het
Tg A C 15: 66,740,718 E375A probably damaging Het
Tmem176b A G 6: 48,838,353 V2A probably benign Het
Toporsl G A 4: 52,610,281 C58Y probably damaging Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Vav3 T C 3: 109,563,094 probably benign Het
Zfp180 T A 7: 24,104,745 D196E possibly damaging Het
Zfp407 C T 18: 84,209,955 S1843N probably damaging Het
Other mutations in Pax8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Pax8 APN 2 24443132 missense probably damaging 1.00
IGL01118:Pax8 APN 2 24442932 splice site probably benign
IGL01141:Pax8 APN 2 24441150 missense probably damaging 1.00
IGL01338:Pax8 APN 2 24435919 missense possibly damaging 0.93
IGL01801:Pax8 APN 2 24444564 critical splice donor site probably null
IGL02159:Pax8 APN 2 24440788 missense possibly damaging 0.56
IGL02727:Pax8 APN 2 24441630 missense probably damaging 0.98
IGL02887:Pax8 APN 2 24444615 missense probably damaging 1.00
R1499:Pax8 UTSW 2 24429596 missense possibly damaging 0.92
R1756:Pax8 UTSW 2 24435821 missense probably damaging 0.98
R2051:Pax8 UTSW 2 24436508 missense probably benign
R2234:Pax8 UTSW 2 24443102 missense probably damaging 1.00
R2289:Pax8 UTSW 2 24440740 missense probably benign 0.00
R2306:Pax8 UTSW 2 24443045 missense probably damaging 1.00
R4328:Pax8 UTSW 2 24441651 missense possibly damaging 0.92
R4434:Pax8 UTSW 2 24429609 missense possibly damaging 0.93
R4592:Pax8 UTSW 2 24443189 intron probably benign
R4610:Pax8 UTSW 2 24421583 missense probably damaging 0.99
R4873:Pax8 UTSW 2 24441640 missense probably benign 0.04
R4875:Pax8 UTSW 2 24441640 missense probably benign 0.04
R5394:Pax8 UTSW 2 24442910 intron probably benign
R5924:Pax8 UTSW 2 24421622 missense probably damaging 0.97
R6796:Pax8 UTSW 2 24441086 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GTTGTCTAGATGAAGACCAAACAGG -3'
(R):5'- TGCCACAGCCTTTGACCATC -3'

Sequencing Primer
(F):5'- TGGCCCTGTACACCCTCAG -3'
(R):5'- ACAGCCTTTGACCATCTGTAG -3'
Posted On2017-01-30