Incidental Mutation 'R0554:Hmcn1'
ID 45315
Institutional Source Beutler Lab
Gene Symbol Hmcn1
Ensembl Gene ENSMUSG00000066842
Gene Name hemicentin 1
Synonyms EG545370, LOC240793
MMRRC Submission 038746-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0554 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 150438275-150869186 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 150594868 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 1867 (N1867S)
Ref Sequence ENSEMBL: ENSMUSP00000121500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074783] [ENSMUST00000137197]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000074783
AA Change: N1867S

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000074340
Gene: ENSMUSG00000066842
AA Change: N1867S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 39 213 3e-1 SMART
IG_like 445 506 1.13e0 SMART
IGc2 532 598 2.32e-8 SMART
IGc2 624 688 1.24e-8 SMART
IGc2 714 779 7.52e-8 SMART
IGc2 805 874 2.19e-9 SMART
IGc2 902 967 5.15e-15 SMART
IGc2 993 1058 1.28e-10 SMART
IGc2 1092 1157 1.69e-10 SMART
IGc2 1183 1247 1.09e-13 SMART
IGc2 1278 1344 6.49e-12 SMART
IGc2 1372 1437 5.2e-11 SMART
IGc2 1465 1531 1.34e-13 SMART
IGc2 1559 1624 6.25e-14 SMART
IGc2 1653 1718 4.06e-13 SMART
IGc2 1746 1811 4.12e-14 SMART
IGc2 1838 1904 5.92e-15 SMART
IGc2 1932 1997 7.69e-14 SMART
IGc2 2023 2089 3.3e-13 SMART
IGc2 2115 2180 5e-13 SMART
IGc2 2208 2275 1.32e-12 SMART
IGc2 2304 2369 2.91e-14 SMART
IGc2 2398 2463 4e-12 SMART
IGc2 2491 2556 1.94e-19 SMART
IGc2 2587 2652 2.54e-14 SMART
IGc2 2686 2751 7.57e-13 SMART
IGc2 2789 2854 4.88e-16 SMART
IGc2 2884 2949 2.7e-9 SMART
IGc2 2976 3041 1.47e-10 SMART
IGc2 3071 3136 2.24e-15 SMART
IGc2 3163 3230 8.83e-14 SMART
IGc2 3258 3325 9.76e-16 SMART
IGc2 3354 3419 1.54e-13 SMART
IGc2 3447 3512 4.35e-13 SMART
IGc2 3540 3605 2e-12 SMART
IGc2 3633 3698 7.69e-14 SMART
IGc2 3724 3789 1.92e-14 SMART
IGc2 3815 3882 2.58e-6 SMART
IGc2 3908 3973 6.4e-11 SMART
IGc2 3999 4064 2.78e-11 SMART
IGc2 4090 4154 1.74e-12 SMART
low complexity region 4155 4160 N/A INTRINSIC
IGc2 4180 4245 3.35e-14 SMART
IGc2 4271 4334 8.12e-13 SMART
IGc2 4361 4425 1.79e-14 SMART
IGc2 4451 4515 1.06e-11 SMART
TSP1 4531 4583 4.72e-15 SMART
TSP1 4588 4640 2.39e-16 SMART
TSP1 4645 4697 1.67e-15 SMART
TSP1 4702 4754 2.2e-15 SMART
TSP1 4759 4811 2.77e-12 SMART
TSP1 4816 4868 2.67e-14 SMART
Pfam:G2F 4869 5051 1.5e-57 PFAM
EGF_CA 5106 5145 4.38e-11 SMART
EGF_CA 5146 5190 4.49e-8 SMART
EGF_CA 5191 5228 2.38e-12 SMART
EGF_CA 5229 5270 6.8e-8 SMART
EGF_CA 5271 5313 3.51e-10 SMART
EGF_CA 5314 5354 4.32e-10 SMART
low complexity region 5384 5400 N/A INTRINSIC
low complexity region 5401 5412 N/A INTRINSIC
EGF_CA 5431 5470 2.78e-13 SMART
EGF 5474 5516 1.44e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137197
AA Change: N1867S

PolyPhen 2 Score 0.341 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000121500
Gene: ENSMUSG00000066842
AA Change: N1867S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 39 213 3e-1 SMART
IG_like 445 506 1.13e0 SMART
IGc2 532 598 2.32e-8 SMART
IGc2 624 688 1.24e-8 SMART
IGc2 714 779 7.52e-8 SMART
IGc2 805 874 2.19e-9 SMART
IGc2 902 967 5.15e-15 SMART
IGc2 993 1058 1.28e-10 SMART
IGc2 1092 1157 1.69e-10 SMART
IGc2 1183 1247 1.09e-13 SMART
IGc2 1278 1344 6.49e-12 SMART
IGc2 1372 1437 5.2e-11 SMART
IGc2 1465 1531 1.34e-13 SMART
IGc2 1559 1624 6.25e-14 SMART
IGc2 1653 1718 4.06e-13 SMART
IGc2 1746 1811 4.12e-14 SMART
IGc2 1838 1904 5.92e-15 SMART
IGc2 1932 1997 7.69e-14 SMART
IGc2 2023 2089 3.3e-13 SMART
IGc2 2115 2180 5e-13 SMART
IGc2 2208 2275 1.32e-12 SMART
IGc2 2304 2369 2.91e-14 SMART
IGc2 2398 2463 4e-12 SMART
IGc2 2491 2556 1.94e-19 SMART
IGc2 2587 2652 2.54e-14 SMART
IGc2 2686 2751 7.57e-13 SMART
IGc2 2789 2854 4.88e-16 SMART
IGc2 2884 2949 2.7e-9 SMART
IGc2 2976 3041 1.47e-10 SMART
IGc2 3071 3136 2.24e-15 SMART
IGc2 3163 3230 8.83e-14 SMART
IGc2 3258 3325 9.76e-16 SMART
IGc2 3354 3419 1.54e-13 SMART
IGc2 3447 3512 4.35e-13 SMART
IGc2 3540 3605 2e-12 SMART
IGc2 3633 3698 7.69e-14 SMART
IGc2 3724 3789 1.92e-14 SMART
IGc2 3815 3882 2.58e-6 SMART
IGc2 3908 3973 6.4e-11 SMART
IGc2 3999 4064 2.78e-11 SMART
IGc2 4090 4154 1.74e-12 SMART
low complexity region 4155 4160 N/A INTRINSIC
IGc2 4180 4245 3.35e-14 SMART
IGc2 4271 4334 8.12e-13 SMART
IGc2 4361 4425 1.79e-14 SMART
IGc2 4451 4515 1.06e-11 SMART
TSP1 4531 4583 4.72e-15 SMART
TSP1 4588 4640 2.39e-16 SMART
TSP1 4645 4697 1.67e-15 SMART
TSP1 4702 4754 2.2e-15 SMART
TSP1 4759 4811 2.77e-12 SMART
TSP1 4816 4868 2.67e-14 SMART
PDB:1GL4|A 4869 5082 3e-6 PDB
SCOP:d1gl4a1 4869 5082 3e-79 SMART
EGF_CA 5106 5145 4.38e-11 SMART
EGF_CA 5146 5190 4.49e-8 SMART
EGF_CA 5191 5228 2.38e-12 SMART
EGF_CA 5229 5270 6.8e-8 SMART
EGF_CA 5271 5313 3.51e-10 SMART
EGF_CA 5314 5353 2.78e-13 SMART
EGF 5357 5399 1.44e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177268
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large extracellular member of the immunoglobulin superfamily. A similar protein in C. elegans forms long, fine tracks at specific extracellular sites that are involved in many processes such as stabilization of the germline syncytium, anchorage of mechanosensory neurons to the epidermis, and organization of hemidesmosomes in the epidermis. Mutations in this gene may be associated with age-related macular degeneration. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T A 5: 144,982,181 (GRCm39) Y255* probably null Het
1810024B03Rik A G 2: 127,029,196 (GRCm39) M1T probably null Het
4930503L19Rik T C 18: 70,600,451 (GRCm39) D386G probably damaging Het
Ace2 T A X: 162,958,947 (GRCm39) N601K probably benign Het
Adam4 A C 12: 81,468,198 (GRCm39) I141R probably damaging Het
Adcy10 G A 1: 165,340,699 (GRCm39) G235S probably benign Het
Adcy5 G A 16: 35,114,387 (GRCm39) V997I probably benign Het
Aff2 T G X: 68,907,680 (GRCm39) W1221G possibly damaging Het
Ankrd44 T C 1: 54,802,917 (GRCm39) N194D probably benign Het
Apba2 T G 7: 64,395,528 (GRCm39) L668R probably damaging Het
Asph T C 4: 9,604,581 (GRCm39) D152G probably damaging Het
Bcl3 C G 7: 19,553,991 (GRCm39) V126L probably benign Het
Cd163 A G 6: 124,289,619 (GRCm39) T446A probably benign Het
Cd209g C T 8: 4,184,995 (GRCm39) probably benign Het
Cdadc1 A T 14: 59,823,901 (GRCm39) V197E probably damaging Het
CN725425 T C 15: 91,144,966 (GRCm39) C610R possibly damaging Het
Col6a2 A G 10: 76,446,995 (GRCm39) probably null Het
Coro7 A G 16: 4,450,121 (GRCm39) L576P possibly damaging Het
Dgkb T A 12: 38,266,030 (GRCm39) V503E probably benign Het
Dhx57 A T 17: 80,567,665 (GRCm39) L806* probably null Het
Dlec1 T C 9: 118,944,070 (GRCm39) V373A probably benign Het
Dnah11 G T 12: 117,894,913 (GRCm39) R3645S probably benign Het
Dnhd1 T C 7: 105,343,602 (GRCm39) S1649P probably benign Het
Draxin T G 4: 148,192,420 (GRCm39) K297N probably damaging Het
Epha7 T C 4: 28,951,401 (GRCm39) S841P probably damaging Het
Esp8 T G 17: 40,841,166 (GRCm39) D142E unknown Het
F5 T G 1: 164,007,018 (GRCm39) V274G probably damaging Het
Fancc T C 13: 63,465,283 (GRCm39) S475G probably benign Het
Fmo3 T C 1: 162,781,901 (GRCm39) N484S probably benign Het
Focad T C 4: 88,267,126 (GRCm39) Y1046H unknown Het
Furin C T 7: 80,041,032 (GRCm39) G602D probably damaging Het
Fut8 A T 12: 77,411,744 (GRCm39) I69L probably benign Het
Gnai3 A G 3: 108,030,928 (GRCm39) I78T probably benign Het
Gpr182 T C 10: 127,586,940 (GRCm39) I4V probably benign Het
Gpr63 T C 4: 25,007,447 (GRCm39) M57T probably benign Het
Grm1 T A 10: 10,595,667 (GRCm39) T654S probably benign Het
Gtf2h4 T C 17: 35,979,531 (GRCm39) T371A probably benign Het
Helq T C 5: 100,938,066 (GRCm39) N460S probably benign Het
Hsh2d G A 8: 72,954,304 (GRCm39) D229N probably benign Het
Iigp1c G A 18: 60,378,489 (GRCm39) R8H probably benign Het
Inpp5j A G 11: 3,449,644 (GRCm39) Y713H probably damaging Het
Ints6 A T 14: 62,942,200 (GRCm39) V511D possibly damaging Het
Irag2 G A 6: 145,111,013 (GRCm39) A237T probably benign Het
Itga4 A G 2: 79,109,461 (GRCm39) Y220C probably damaging Het
Itgav T G 2: 83,624,614 (GRCm39) S735A possibly damaging Het
Kctd16 A G 18: 40,391,492 (GRCm39) I27V probably benign Het
Klhl6 T C 16: 19,772,343 (GRCm39) E334G probably damaging Het
Ltbp1 T A 17: 75,532,274 (GRCm39) L116H probably damaging Het
Magohb T A 6: 131,262,660 (GRCm39) H98L probably benign Het
Mgat2 A G 12: 69,232,166 (GRCm39) T247A probably benign Het
Mtif2 G A 11: 29,483,398 (GRCm39) probably null Het
Myrfl T C 10: 116,664,878 (GRCm39) E384G probably damaging Het
Nfam1 G T 15: 82,917,410 (GRCm39) R8S probably benign Het
Numa1 T C 7: 101,644,731 (GRCm39) S236P possibly damaging Het
Or14c46 A T 7: 85,918,865 (GRCm39) I44N probably damaging Het
Or2w3b T C 11: 58,623,865 (GRCm39) N42S probably damaging Het
Or5m10b T C 2: 85,699,863 (GRCm39) F309S probably benign Het
Or6c207 T C 10: 129,104,368 (GRCm39) T275A probably benign Het
Orc4 C T 2: 48,795,433 (GRCm39) S431N probably benign Het
Pax2 T C 19: 44,750,300 (GRCm39) V129A probably damaging Het
Pcdhb15 A G 18: 37,607,572 (GRCm39) D268G probably damaging Het
Pdcd1 G A 1: 93,967,107 (GRCm39) R264C probably damaging Het
Pi15 T A 1: 17,691,872 (GRCm39) M187K probably benign Het
Plag1 C T 4: 3,904,546 (GRCm39) C215Y probably damaging Het
Plagl1 A G 10: 13,002,926 (GRCm39) T65A probably benign Het
Pramel51 T C 12: 88,144,328 (GRCm39) T162A probably benign Het
Prss48 T A 3: 85,908,228 (GRCm39) Q18L probably benign Het
Prune2 T A 19: 17,102,582 (GRCm39) C2580* probably null Het
Rab40b T A 11: 121,250,432 (GRCm39) Q74L probably damaging Het
Raf1 A G 6: 115,600,491 (GRCm39) I376T probably benign Het
Rbm46 A T 3: 82,772,575 (GRCm39) F186I probably damaging Het
Reps1 C T 10: 17,998,867 (GRCm39) T720M possibly damaging Het
Rgs22 A G 15: 36,054,855 (GRCm39) M649T probably benign Het
Rhot1 C T 11: 80,134,264 (GRCm39) R47* probably null Het
Rhox2f A G X: 36,753,124 (GRCm39) Y8C possibly damaging Het
Rnf17 A G 14: 56,760,007 (GRCm39) Y1604C probably damaging Het
Rnf40 T C 7: 127,201,756 (GRCm39) C943R probably damaging Het
Ropn1l A T 15: 31,451,295 (GRCm39) M63K probably benign Het
Sbf2 C A 7: 110,027,494 (GRCm39) V501F probably damaging Het
Sh3bp1 T A 15: 78,791,467 (GRCm39) M354K probably damaging Het
Sipa1l3 T C 7: 29,087,455 (GRCm39) H590R possibly damaging Het
Slco6d1 T A 1: 98,394,422 (GRCm39) C369S probably benign Het
Sulf1 T C 1: 12,875,418 (GRCm39) Y143H probably damaging Het
Tiam2 A T 17: 3,488,956 (GRCm39) R755* probably null Het
Trim12c C A 7: 103,994,169 (GRCm39) L228F probably damaging Het
Ttc23l G T 15: 10,530,743 (GRCm39) Q290K probably benign Het
Uba3 T C 6: 97,168,221 (GRCm39) probably null Het
Ugt1a10 A G 1: 87,983,817 (GRCm39) E205G probably damaging Het
Ugt3a1 T A 15: 9,351,206 (GRCm39) S72T probably benign Het
Upk3bl C T 5: 136,088,648 (GRCm39) T113I probably damaging Het
Uspl1 T A 5: 149,124,644 (GRCm39) D20E probably damaging Het
Vmn2r19 G A 6: 123,313,102 (GRCm39) G724E probably damaging Het
Vmn2r63 T A 7: 42,583,129 (GRCm39) K29* probably null Het
Vwf C T 6: 125,619,744 (GRCm39) A1474V probably benign Het
Xpc C T 6: 91,468,208 (GRCm39) A860T probably benign Het
Zfp462 A G 4: 55,013,689 (GRCm39) H737R probably damaging Het
Zfp536 T C 7: 37,180,244 (GRCm39) D787G probably damaging Het
Zfp692 A G 11: 58,205,053 (GRCm39) H434R probably damaging Het
Zp1 C A 19: 10,897,926 (GRCm39) C5F probably benign Het
Other mutations in Hmcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Hmcn1 APN 1 150,553,029 (GRCm39) missense probably benign
IGL00571:Hmcn1 APN 1 150,514,750 (GRCm39) missense probably benign 0.05
IGL00726:Hmcn1 APN 1 150,682,117 (GRCm39) critical splice donor site probably null
IGL00802:Hmcn1 APN 1 150,540,687 (GRCm39) missense probably benign 0.19
IGL00824:Hmcn1 APN 1 150,532,485 (GRCm39) missense probably damaging 1.00
IGL00834:Hmcn1 APN 1 150,506,091 (GRCm39) missense probably benign 0.00
IGL00843:Hmcn1 APN 1 150,486,464 (GRCm39) missense possibly damaging 0.95
IGL00845:Hmcn1 APN 1 150,480,757 (GRCm39) missense probably damaging 0.98
IGL00851:Hmcn1 APN 1 150,458,052 (GRCm39) missense probably benign 0.02
IGL00909:Hmcn1 APN 1 150,514,620 (GRCm39) missense probably benign 0.12
IGL01074:Hmcn1 APN 1 150,502,784 (GRCm39) missense possibly damaging 0.82
IGL01112:Hmcn1 APN 1 150,508,303 (GRCm39) splice site probably benign
IGL01304:Hmcn1 APN 1 150,498,675 (GRCm39) missense probably damaging 0.99
IGL01307:Hmcn1 APN 1 150,620,752 (GRCm39) missense possibly damaging 0.84
IGL01318:Hmcn1 APN 1 150,594,991 (GRCm39) missense probably damaging 1.00
IGL01403:Hmcn1 APN 1 150,468,848 (GRCm39) missense probably damaging 1.00
IGL01417:Hmcn1 APN 1 150,734,990 (GRCm39) missense probably damaging 1.00
IGL01503:Hmcn1 APN 1 150,480,823 (GRCm39) missense probably benign 0.38
IGL01509:Hmcn1 APN 1 150,485,382 (GRCm39) missense probably damaging 1.00
IGL01550:Hmcn1 APN 1 150,474,148 (GRCm39) missense probably damaging 1.00
IGL01601:Hmcn1 APN 1 150,503,164 (GRCm39) missense probably benign 0.01
IGL01617:Hmcn1 APN 1 150,547,783 (GRCm39) missense probably benign 0.05
IGL01636:Hmcn1 APN 1 150,455,984 (GRCm39) missense probably damaging 1.00
IGL01662:Hmcn1 APN 1 150,613,050 (GRCm39) missense possibly damaging 0.46
IGL01693:Hmcn1 APN 1 150,459,031 (GRCm39) missense probably damaging 1.00
IGL01723:Hmcn1 APN 1 150,620,711 (GRCm39) missense probably benign 0.01
IGL01776:Hmcn1 APN 1 150,547,789 (GRCm39) missense possibly damaging 0.70
IGL01783:Hmcn1 APN 1 150,491,051 (GRCm39) missense possibly damaging 0.60
IGL01789:Hmcn1 APN 1 150,566,352 (GRCm39) missense probably damaging 1.00
IGL01900:Hmcn1 APN 1 150,618,011 (GRCm39) splice site probably benign
IGL01906:Hmcn1 APN 1 150,543,638 (GRCm39) missense probably benign 0.01
IGL01947:Hmcn1 APN 1 150,608,643 (GRCm39) missense possibly damaging 0.93
IGL01958:Hmcn1 APN 1 150,479,622 (GRCm39) missense probably benign 0.01
IGL02002:Hmcn1 APN 1 150,491,049 (GRCm39) missense probably damaging 1.00
IGL02058:Hmcn1 APN 1 150,579,932 (GRCm39) missense probably benign 0.02
IGL02115:Hmcn1 APN 1 150,506,479 (GRCm39) missense probably damaging 1.00
IGL02127:Hmcn1 APN 1 150,598,358 (GRCm39) missense probably benign
IGL02155:Hmcn1 APN 1 150,439,349 (GRCm39) missense probably damaging 1.00
IGL02222:Hmcn1 APN 1 150,682,152 (GRCm39) missense probably benign 0.05
IGL02293:Hmcn1 APN 1 150,540,666 (GRCm39) missense probably damaging 0.97
IGL02398:Hmcn1 APN 1 150,678,648 (GRCm39) missense possibly damaging 0.78
IGL02420:Hmcn1 APN 1 150,598,175 (GRCm39) missense probably damaging 1.00
IGL02553:Hmcn1 APN 1 150,868,774 (GRCm39) missense probably benign 0.12
IGL02561:Hmcn1 APN 1 150,685,477 (GRCm39) missense probably benign 0.32
IGL02569:Hmcn1 APN 1 150,573,244 (GRCm39) missense probably benign 0.01
IGL02607:Hmcn1 APN 1 150,620,746 (GRCm39) missense possibly damaging 0.88
IGL02676:Hmcn1 APN 1 150,494,760 (GRCm39) missense probably benign 0.01
IGL02725:Hmcn1 APN 1 150,480,654 (GRCm39) missense possibly damaging 0.92
IGL02726:Hmcn1 APN 1 150,532,445 (GRCm39) nonsense probably null
IGL02735:Hmcn1 APN 1 150,522,583 (GRCm39) missense probably benign 0.02
IGL02737:Hmcn1 APN 1 150,439,579 (GRCm39) missense probably damaging 1.00
IGL02892:Hmcn1 APN 1 150,551,725 (GRCm39) critical splice donor site probably null
IGL02927:Hmcn1 APN 1 150,453,029 (GRCm39) missense probably damaging 1.00
IGL02931:Hmcn1 APN 1 150,532,958 (GRCm39) missense probably benign 0.37
IGL02936:Hmcn1 APN 1 150,573,273 (GRCm39) missense probably damaging 0.98
IGL02985:Hmcn1 APN 1 150,547,668 (GRCm39) missense probably damaging 1.00
IGL03027:Hmcn1 APN 1 150,684,290 (GRCm39) missense probably benign
IGL03195:Hmcn1 APN 1 150,678,660 (GRCm39) missense probably benign 0.06
IGL03217:Hmcn1 APN 1 150,619,418 (GRCm39) missense possibly damaging 0.58
IGL03232:Hmcn1 APN 1 150,646,103 (GRCm39) splice site probably benign
IGL03268:Hmcn1 APN 1 150,648,261 (GRCm39) missense probably damaging 1.00
IGL03271:Hmcn1 APN 1 150,474,175 (GRCm39) missense possibly damaging 0.92
IGL03304:Hmcn1 APN 1 150,505,982 (GRCm39) missense probably damaging 0.97
IGL03329:Hmcn1 APN 1 150,608,661 (GRCm39) missense probably damaging 1.00
IGL03339:Hmcn1 APN 1 150,577,720 (GRCm39) missense probably benign 0.04
IGL03368:Hmcn1 APN 1 150,539,623 (GRCm39) missense probably damaging 1.00
Backbone UTSW 1 150,498,745 (GRCm39) missense probably benign 0.09
Cambrian UTSW 1 150,608,597 (GRCm39) missense probably damaging 1.00
chordate UTSW 1 150,462,766 (GRCm39) missense probably benign 0.00
Justamere UTSW 1 150,464,008 (GRCm39) missense probably damaging 1.00
Lancelet UTSW 1 150,551,291 (GRCm39) missense probably benign 0.00
notochord UTSW 1 150,646,044 (GRCm39) missense probably benign 0.00
wippoorwill UTSW 1 150,608,697 (GRCm39) missense probably damaging 1.00
BB004:Hmcn1 UTSW 1 150,485,526 (GRCm39) missense probably damaging 1.00
BB014:Hmcn1 UTSW 1 150,485,526 (GRCm39) missense probably damaging 1.00
IGL02991:Hmcn1 UTSW 1 150,614,409 (GRCm39) missense possibly damaging 0.56
P0017:Hmcn1 UTSW 1 150,596,440 (GRCm39) missense possibly damaging 0.49
PIT1430001:Hmcn1 UTSW 1 150,684,488 (GRCm39) missense probably benign 0.00
PIT4514001:Hmcn1 UTSW 1 150,545,238 (GRCm39) missense possibly damaging 0.93
R0006:Hmcn1 UTSW 1 150,684,427 (GRCm39) missense probably damaging 0.99
R0018:Hmcn1 UTSW 1 150,528,302 (GRCm39) missense probably benign 0.16
R0052:Hmcn1 UTSW 1 150,553,157 (GRCm39) missense probably damaging 1.00
R0107:Hmcn1 UTSW 1 150,462,766 (GRCm39) missense probably benign 0.00
R0115:Hmcn1 UTSW 1 150,684,398 (GRCm39) missense possibly damaging 0.88
R0149:Hmcn1 UTSW 1 150,553,075 (GRCm39) missense probably benign 0.00
R0152:Hmcn1 UTSW 1 150,539,630 (GRCm39) missense probably benign 0.01
R0381:Hmcn1 UTSW 1 150,479,562 (GRCm39) missense probably damaging 1.00
R0398:Hmcn1 UTSW 1 150,674,565 (GRCm39) missense possibly damaging 0.83
R0414:Hmcn1 UTSW 1 150,591,573 (GRCm39) missense possibly damaging 0.72
R0494:Hmcn1 UTSW 1 150,608,543 (GRCm39) splice site probably benign
R0503:Hmcn1 UTSW 1 150,735,003 (GRCm39) missense probably damaging 1.00
R0504:Hmcn1 UTSW 1 150,752,170 (GRCm39) splice site probably benign
R0506:Hmcn1 UTSW 1 150,618,092 (GRCm39) missense possibly damaging 0.69
R0576:Hmcn1 UTSW 1 150,525,768 (GRCm39) nonsense probably null
R0599:Hmcn1 UTSW 1 150,485,552 (GRCm39) missense possibly damaging 0.91
R0605:Hmcn1 UTSW 1 150,533,127 (GRCm39) critical splice donor site probably null
R0607:Hmcn1 UTSW 1 150,514,651 (GRCm39) missense probably benign 0.01
R0620:Hmcn1 UTSW 1 150,469,767 (GRCm39) missense probably benign 0.04
R0626:Hmcn1 UTSW 1 150,674,470 (GRCm39) splice site probably null
R0699:Hmcn1 UTSW 1 150,695,161 (GRCm39) missense probably damaging 1.00
R0765:Hmcn1 UTSW 1 150,684,538 (GRCm39) missense probably damaging 1.00
R0782:Hmcn1 UTSW 1 150,629,416 (GRCm39) missense possibly damaging 0.82
R0783:Hmcn1 UTSW 1 150,525,824 (GRCm39) missense probably damaging 1.00
R0841:Hmcn1 UTSW 1 150,555,358 (GRCm39) splice site probably null
R0975:Hmcn1 UTSW 1 150,453,128 (GRCm39) missense probably benign 0.00
R1070:Hmcn1 UTSW 1 150,565,341 (GRCm39) missense probably damaging 0.98
R1118:Hmcn1 UTSW 1 150,494,679 (GRCm39) missense possibly damaging 0.56
R1119:Hmcn1 UTSW 1 150,494,679 (GRCm39) missense possibly damaging 0.56
R1145:Hmcn1 UTSW 1 150,555,358 (GRCm39) splice site probably null
R1145:Hmcn1 UTSW 1 150,555,358 (GRCm39) splice site probably null
R1233:Hmcn1 UTSW 1 150,624,777 (GRCm39) missense probably benign
R1234:Hmcn1 UTSW 1 150,629,405 (GRCm39) nonsense probably null
R1291:Hmcn1 UTSW 1 150,623,942 (GRCm39) missense probably damaging 1.00
R1334:Hmcn1 UTSW 1 150,462,219 (GRCm39) missense possibly damaging 0.73
R1372:Hmcn1 UTSW 1 150,556,466 (GRCm39) missense probably benign 0.22
R1424:Hmcn1 UTSW 1 150,522,545 (GRCm39) missense probably benign 0.00
R1450:Hmcn1 UTSW 1 150,528,257 (GRCm39) splice site probably benign
R1458:Hmcn1 UTSW 1 150,485,451 (GRCm39) missense probably damaging 1.00
R1467:Hmcn1 UTSW 1 150,565,341 (GRCm39) missense probably damaging 0.98
R1467:Hmcn1 UTSW 1 150,565,341 (GRCm39) missense probably damaging 0.98
R1473:Hmcn1 UTSW 1 150,648,303 (GRCm39) missense probably benign 0.03
R1517:Hmcn1 UTSW 1 150,545,172 (GRCm39) missense probably damaging 1.00
R1527:Hmcn1 UTSW 1 150,649,554 (GRCm39) missense probably benign 0.00
R1557:Hmcn1 UTSW 1 150,610,283 (GRCm39) missense possibly damaging 0.86
R1576:Hmcn1 UTSW 1 150,532,992 (GRCm39) missense possibly damaging 0.77
R1617:Hmcn1 UTSW 1 150,620,778 (GRCm39) missense probably damaging 0.98
R1635:Hmcn1 UTSW 1 150,545,309 (GRCm39) missense probably benign 0.00
R1655:Hmcn1 UTSW 1 150,506,084 (GRCm39) missense probably benign 0.03
R1698:Hmcn1 UTSW 1 150,441,120 (GRCm39) nonsense probably null
R1710:Hmcn1 UTSW 1 150,551,735 (GRCm39) missense probably damaging 1.00
R1717:Hmcn1 UTSW 1 150,734,937 (GRCm39) missense probably damaging 1.00
R1753:Hmcn1 UTSW 1 150,462,219 (GRCm39) missense possibly damaging 0.73
R1756:Hmcn1 UTSW 1 150,474,781 (GRCm39) missense probably damaging 1.00
R1772:Hmcn1 UTSW 1 150,439,319 (GRCm39) missense probably damaging 0.99
R1793:Hmcn1 UTSW 1 150,624,834 (GRCm39) missense probably benign 0.01
R1794:Hmcn1 UTSW 1 150,502,903 (GRCm39) missense probably damaging 0.98
R1794:Hmcn1 UTSW 1 150,474,036 (GRCm39) missense probably benign 0.00
R1856:Hmcn1 UTSW 1 150,597,415 (GRCm39) missense probably benign 0.02
R1859:Hmcn1 UTSW 1 150,532,944 (GRCm39) missense probably damaging 1.00
R1862:Hmcn1 UTSW 1 150,514,651 (GRCm39) missense probably benign 0.01
R1865:Hmcn1 UTSW 1 150,479,563 (GRCm39) missense probably damaging 1.00
R1874:Hmcn1 UTSW 1 150,596,446 (GRCm39) missense probably damaging 1.00
R1880:Hmcn1 UTSW 1 150,514,651 (GRCm39) missense probably benign 0.01
R1881:Hmcn1 UTSW 1 150,514,651 (GRCm39) missense probably benign 0.01
R1886:Hmcn1 UTSW 1 150,453,046 (GRCm39) missense probably benign 0.02
R1888:Hmcn1 UTSW 1 150,695,251 (GRCm39) missense possibly damaging 0.82
R1888:Hmcn1 UTSW 1 150,695,251 (GRCm39) missense possibly damaging 0.82
R1899:Hmcn1 UTSW 1 150,533,202 (GRCm39) missense probably damaging 1.00
R1905:Hmcn1 UTSW 1 150,868,606 (GRCm39) missense probably damaging 1.00
R1912:Hmcn1 UTSW 1 150,480,633 (GRCm39) missense probably benign 0.28
R1959:Hmcn1 UTSW 1 150,525,427 (GRCm39) missense probably benign 0.00
R1960:Hmcn1 UTSW 1 150,553,127 (GRCm39) missense possibly damaging 0.72
R1960:Hmcn1 UTSW 1 150,551,742 (GRCm39) missense probably benign 0.00
R2001:Hmcn1 UTSW 1 150,614,364 (GRCm39) missense possibly damaging 0.81
R2011:Hmcn1 UTSW 1 150,553,085 (GRCm39) missense probably benign 0.01
R2075:Hmcn1 UTSW 1 150,453,074 (GRCm39) missense possibly damaging 0.86
R2136:Hmcn1 UTSW 1 150,509,410 (GRCm39) missense probably damaging 1.00
R2192:Hmcn1 UTSW 1 150,591,566 (GRCm39) missense probably damaging 0.97
R2267:Hmcn1 UTSW 1 150,474,761 (GRCm39) missense probably benign 0.00
R2268:Hmcn1 UTSW 1 150,500,349 (GRCm39) splice site probably benign
R2303:Hmcn1 UTSW 1 150,579,977 (GRCm39) missense probably damaging 1.00
R2330:Hmcn1 UTSW 1 150,528,429 (GRCm39) splice site probably benign
R2338:Hmcn1 UTSW 1 150,498,685 (GRCm39) missense possibly damaging 0.89
R2380:Hmcn1 UTSW 1 150,441,135 (GRCm39) missense probably benign 0.01
R2405:Hmcn1 UTSW 1 150,736,092 (GRCm39) missense probably damaging 1.00
R2443:Hmcn1 UTSW 1 150,474,783 (GRCm39) missense probably benign 0.01
R2496:Hmcn1 UTSW 1 150,490,972 (GRCm39) missense probably benign 0.01
R2504:Hmcn1 UTSW 1 150,562,618 (GRCm39) nonsense probably null
R2519:Hmcn1 UTSW 1 150,649,571 (GRCm39) nonsense probably null
R2520:Hmcn1 UTSW 1 150,619,398 (GRCm39) missense possibly damaging 0.72
R2679:Hmcn1 UTSW 1 150,528,326 (GRCm39) missense possibly damaging 0.67
R2831:Hmcn1 UTSW 1 150,506,403 (GRCm39) critical splice donor site probably null
R2847:Hmcn1 UTSW 1 150,439,350 (GRCm39) nonsense probably null
R2849:Hmcn1 UTSW 1 150,439,350 (GRCm39) nonsense probably null
R2869:Hmcn1 UTSW 1 150,614,467 (GRCm39) missense possibly damaging 0.95
R2869:Hmcn1 UTSW 1 150,614,467 (GRCm39) missense possibly damaging 0.95
R2871:Hmcn1 UTSW 1 150,614,467 (GRCm39) missense possibly damaging 0.95
R2871:Hmcn1 UTSW 1 150,614,467 (GRCm39) missense possibly damaging 0.95
R2872:Hmcn1 UTSW 1 150,614,467 (GRCm39) missense possibly damaging 0.95
R2872:Hmcn1 UTSW 1 150,614,467 (GRCm39) missense possibly damaging 0.95
R2873:Hmcn1 UTSW 1 150,614,467 (GRCm39) missense possibly damaging 0.95
R2897:Hmcn1 UTSW 1 150,678,624 (GRCm39) missense probably damaging 1.00
R2905:Hmcn1 UTSW 1 150,624,786 (GRCm39) missense probably damaging 1.00
R3498:Hmcn1 UTSW 1 150,480,853 (GRCm39) missense probably damaging 0.98
R3499:Hmcn1 UTSW 1 150,480,853 (GRCm39) missense probably damaging 0.98
R3724:Hmcn1 UTSW 1 150,565,269 (GRCm39) missense possibly damaging 0.82
R3765:Hmcn1 UTSW 1 150,620,776 (GRCm39) missense possibly damaging 0.72
R3778:Hmcn1 UTSW 1 150,678,575 (GRCm39) missense possibly damaging 0.95
R3790:Hmcn1 UTSW 1 150,498,745 (GRCm39) missense probably benign 0.09
R3796:Hmcn1 UTSW 1 150,462,169 (GRCm39) missense probably damaging 1.00
R3811:Hmcn1 UTSW 1 150,525,328 (GRCm39) critical splice donor site probably null
R3825:Hmcn1 UTSW 1 150,462,716 (GRCm39) missense probably benign 0.28
R3890:Hmcn1 UTSW 1 150,510,946 (GRCm39) missense probably damaging 1.00
R3891:Hmcn1 UTSW 1 150,510,946 (GRCm39) missense probably damaging 1.00
R3892:Hmcn1 UTSW 1 150,510,946 (GRCm39) missense probably damaging 1.00
R3918:Hmcn1 UTSW 1 150,566,361 (GRCm39) missense probably benign 0.00
R3964:Hmcn1 UTSW 1 150,449,320 (GRCm39) missense probably benign 0.00
R4005:Hmcn1 UTSW 1 150,598,204 (GRCm39) missense possibly damaging 0.88
R4026:Hmcn1 UTSW 1 150,598,120 (GRCm39) missense probably benign 0.03
R4037:Hmcn1 UTSW 1 150,648,253 (GRCm39) missense probably benign 0.00
R4088:Hmcn1 UTSW 1 150,578,967 (GRCm39) missense possibly damaging 0.58
R4096:Hmcn1 UTSW 1 150,534,259 (GRCm39) missense probably benign 0.20
R4169:Hmcn1 UTSW 1 150,471,750 (GRCm39) splice site probably null
R4441:Hmcn1 UTSW 1 150,533,210 (GRCm39) missense probably null
R4493:Hmcn1 UTSW 1 150,577,650 (GRCm39) missense probably damaging 1.00
R4501:Hmcn1 UTSW 1 150,509,417 (GRCm39) missense probably damaging 1.00
R4535:Hmcn1 UTSW 1 150,439,531 (GRCm39) missense probably damaging 0.99
R4576:Hmcn1 UTSW 1 150,610,238 (GRCm39) missense probably benign
R4601:Hmcn1 UTSW 1 150,614,396 (GRCm39) missense probably damaging 0.99
R4627:Hmcn1 UTSW 1 150,471,645 (GRCm39) missense probably benign 0.11
R4647:Hmcn1 UTSW 1 150,551,262 (GRCm39) critical splice donor site probably null
R4657:Hmcn1 UTSW 1 150,500,301 (GRCm39) missense probably damaging 1.00
R4717:Hmcn1 UTSW 1 150,494,816 (GRCm39) missense probably benign 0.00
R4721:Hmcn1 UTSW 1 150,648,322 (GRCm39) splice site probably null
R4724:Hmcn1 UTSW 1 150,570,584 (GRCm39) splice site probably null
R4737:Hmcn1 UTSW 1 150,565,346 (GRCm39) missense possibly damaging 0.90
R4744:Hmcn1 UTSW 1 150,453,363 (GRCm39) missense probably damaging 1.00
R4795:Hmcn1 UTSW 1 150,629,362 (GRCm39) missense probably benign 0.00
R4796:Hmcn1 UTSW 1 150,629,362 (GRCm39) missense probably benign 0.00
R4871:Hmcn1 UTSW 1 150,468,836 (GRCm39) missense probably benign 0.02
R4895:Hmcn1 UTSW 1 150,553,130 (GRCm39) missense probably benign 0.00
R4934:Hmcn1 UTSW 1 150,598,286 (GRCm39) missense probably damaging 1.00
R4953:Hmcn1 UTSW 1 150,752,111 (GRCm39) intron probably benign
R4968:Hmcn1 UTSW 1 150,533,221 (GRCm39) missense possibly damaging 0.67
R4974:Hmcn1 UTSW 1 150,695,200 (GRCm39) missense probably benign 0.01
R5024:Hmcn1 UTSW 1 150,556,439 (GRCm39) missense possibly damaging 0.65
R5031:Hmcn1 UTSW 1 150,464,008 (GRCm39) missense probably damaging 1.00
R5093:Hmcn1 UTSW 1 150,613,007 (GRCm39) missense probably benign 0.14
R5096:Hmcn1 UTSW 1 150,486,420 (GRCm39) missense probably damaging 1.00
R5185:Hmcn1 UTSW 1 150,532,492 (GRCm39) missense probably benign 0.03
R5228:Hmcn1 UTSW 1 150,522,452 (GRCm39) missense probably benign 0.00
R5260:Hmcn1 UTSW 1 150,471,612 (GRCm39) missense possibly damaging 0.65
R5264:Hmcn1 UTSW 1 150,555,265 (GRCm39) missense probably benign 0.01
R5282:Hmcn1 UTSW 1 150,458,047 (GRCm39) missense probably damaging 1.00
R5334:Hmcn1 UTSW 1 150,631,123 (GRCm39) missense probably damaging 0.99
R5346:Hmcn1 UTSW 1 150,498,995 (GRCm39) missense probably damaging 1.00
R5423:Hmcn1 UTSW 1 150,577,723 (GRCm39) missense probably damaging 1.00
R5484:Hmcn1 UTSW 1 150,551,291 (GRCm39) missense probably benign 0.00
R5491:Hmcn1 UTSW 1 150,485,576 (GRCm39) splice site probably null
R5531:Hmcn1 UTSW 1 150,619,539 (GRCm39) missense probably damaging 1.00
R5536:Hmcn1 UTSW 1 150,631,042 (GRCm39) missense probably benign 0.01
R5547:Hmcn1 UTSW 1 150,613,257 (GRCm39) missense possibly damaging 0.64
R5580:Hmcn1 UTSW 1 150,453,290 (GRCm39) missense probably benign 0.43
R5626:Hmcn1 UTSW 1 150,532,318 (GRCm39) missense probably damaging 1.00
R5657:Hmcn1 UTSW 1 150,534,313 (GRCm39) missense probably benign 0.02
R5677:Hmcn1 UTSW 1 150,485,529 (GRCm39) missense probably benign 0.00
R5718:Hmcn1 UTSW 1 150,566,351 (GRCm39) nonsense probably null
R5718:Hmcn1 UTSW 1 150,485,417 (GRCm39) missense probably damaging 1.00
R5723:Hmcn1 UTSW 1 150,570,600 (GRCm39) missense possibly damaging 0.95
R5739:Hmcn1 UTSW 1 150,634,225 (GRCm39) splice site probably null
R5739:Hmcn1 UTSW 1 150,684,448 (GRCm39) missense probably benign 0.45
R5751:Hmcn1 UTSW 1 150,449,305 (GRCm39) missense probably damaging 1.00
R5772:Hmcn1 UTSW 1 150,570,629 (GRCm39) missense possibly damaging 0.47
R5804:Hmcn1 UTSW 1 150,550,098 (GRCm39) nonsense probably null
R5809:Hmcn1 UTSW 1 150,525,358 (GRCm39) missense probably damaging 1.00
R5817:Hmcn1 UTSW 1 150,613,275 (GRCm39) missense possibly damaging 0.77
R5824:Hmcn1 UTSW 1 150,868,774 (GRCm39) missense probably benign 0.12
R5881:Hmcn1 UTSW 1 150,506,078 (GRCm39) missense probably damaging 0.99
R5928:Hmcn1 UTSW 1 150,474,648 (GRCm39) missense possibly damaging 0.64
R5929:Hmcn1 UTSW 1 150,453,047 (GRCm39) nonsense probably null
R5940:Hmcn1 UTSW 1 150,532,973 (GRCm39) missense probably benign 0.41
R5973:Hmcn1 UTSW 1 150,439,568 (GRCm39) missense probably damaging 1.00
R5997:Hmcn1 UTSW 1 150,579,924 (GRCm39) missense possibly damaging 0.74
R6027:Hmcn1 UTSW 1 150,678,646 (GRCm39) missense possibly damaging 0.79
R6029:Hmcn1 UTSW 1 150,508,188 (GRCm39) missense probably benign 0.13
R6056:Hmcn1 UTSW 1 150,539,660 (GRCm39) missense probably damaging 1.00
R6065:Hmcn1 UTSW 1 150,646,081 (GRCm39) missense probably benign 0.06
R6083:Hmcn1 UTSW 1 150,631,045 (GRCm39) missense probably damaging 1.00
R6083:Hmcn1 UTSW 1 150,631,044 (GRCm39) missense probably damaging 1.00
R6108:Hmcn1 UTSW 1 150,506,978 (GRCm39) missense possibly damaging 0.95
R6112:Hmcn1 UTSW 1 150,494,687 (GRCm39) missense probably damaging 1.00
R6140:Hmcn1 UTSW 1 150,608,597 (GRCm39) missense probably damaging 1.00
R6144:Hmcn1 UTSW 1 150,598,175 (GRCm39) missense probably damaging 1.00
R6152:Hmcn1 UTSW 1 150,441,176 (GRCm39) missense probably damaging 1.00
R6174:Hmcn1 UTSW 1 150,522,535 (GRCm39) missense probably benign 0.06
R6185:Hmcn1 UTSW 1 150,491,189 (GRCm39) splice site probably null
R6187:Hmcn1 UTSW 1 150,506,479 (GRCm39) missense probably damaging 1.00
R6276:Hmcn1 UTSW 1 150,614,432 (GRCm39) missense possibly damaging 0.69
R6278:Hmcn1 UTSW 1 150,573,170 (GRCm39) critical splice donor site probably null
R6427:Hmcn1 UTSW 1 150,573,227 (GRCm39) missense possibly damaging 0.85
R6431:Hmcn1 UTSW 1 150,620,711 (GRCm39) missense probably benign 0.01
R6441:Hmcn1 UTSW 1 150,578,967 (GRCm39) missense possibly damaging 0.58
R6451:Hmcn1 UTSW 1 150,868,670 (GRCm39) missense probably damaging 1.00
R6478:Hmcn1 UTSW 1 150,540,535 (GRCm39) missense probably damaging 1.00
R6479:Hmcn1 UTSW 1 150,553,053 (GRCm39) nonsense probably null
R6490:Hmcn1 UTSW 1 150,459,029 (GRCm39) missense probably benign 0.00
R6525:Hmcn1 UTSW 1 150,573,317 (GRCm39) missense probably damaging 1.00
R6571:Hmcn1 UTSW 1 150,491,189 (GRCm39) splice site probably null
R6612:Hmcn1 UTSW 1 150,470,869 (GRCm39) critical splice donor site probably null
R6616:Hmcn1 UTSW 1 150,599,008 (GRCm39) critical splice donor site probably null
R6617:Hmcn1 UTSW 1 150,619,547 (GRCm39) missense probably benign 0.01
R6623:Hmcn1 UTSW 1 150,634,057 (GRCm39) missense probably benign
R6687:Hmcn1 UTSW 1 150,620,784 (GRCm39) missense probably benign 0.30
R6714:Hmcn1 UTSW 1 150,579,926 (GRCm39) missense probably damaging 0.97
R6751:Hmcn1 UTSW 1 150,610,269 (GRCm39) missense probably damaging 0.98
R6831:Hmcn1 UTSW 1 150,646,044 (GRCm39) missense probably benign 0.00
R6971:Hmcn1 UTSW 1 150,868,802 (GRCm39) start codon destroyed probably benign 0.00
R7048:Hmcn1 UTSW 1 150,475,404 (GRCm39) critical splice acceptor site probably null
R7058:Hmcn1 UTSW 1 150,649,641 (GRCm39) missense probably benign 0.43
R7071:Hmcn1 UTSW 1 150,479,853 (GRCm39) missense probably damaging 1.00
R7078:Hmcn1 UTSW 1 150,736,118 (GRCm39) missense probably damaging 1.00
R7092:Hmcn1 UTSW 1 150,479,997 (GRCm39) missense probably damaging 1.00
R7120:Hmcn1 UTSW 1 150,576,292 (GRCm39) missense probably damaging 0.98
R7129:Hmcn1 UTSW 1 150,452,961 (GRCm39) splice site probably null
R7144:Hmcn1 UTSW 1 150,539,624 (GRCm39) missense probably damaging 1.00
R7148:Hmcn1 UTSW 1 150,562,605 (GRCm39) missense probably benign 0.00
R7162:Hmcn1 UTSW 1 150,624,744 (GRCm39) missense probably benign 0.18
R7172:Hmcn1 UTSW 1 150,629,450 (GRCm39) missense possibly damaging 0.92
R7193:Hmcn1 UTSW 1 150,525,331 (GRCm39) missense probably null 1.00
R7231:Hmcn1 UTSW 1 150,514,627 (GRCm39) missense probably benign 0.00
R7237:Hmcn1 UTSW 1 150,598,394 (GRCm39) missense probably damaging 0.98
R7258:Hmcn1 UTSW 1 150,591,574 (GRCm39) missense probably benign 0.12
R7286:Hmcn1 UTSW 1 150,458,088 (GRCm39) missense probably damaging 0.98
R7289:Hmcn1 UTSW 1 150,559,466 (GRCm39) missense possibly damaging 0.52
R7292:Hmcn1 UTSW 1 150,608,880 (GRCm39) splice site probably null
R7316:Hmcn1 UTSW 1 150,608,697 (GRCm39) missense probably damaging 1.00
R7327:Hmcn1 UTSW 1 150,479,565 (GRCm39) missense probably benign 0.01
R7328:Hmcn1 UTSW 1 150,514,617 (GRCm39) missense possibly damaging 0.95
R7346:Hmcn1 UTSW 1 150,559,496 (GRCm39) missense probably damaging 1.00
R7351:Hmcn1 UTSW 1 150,543,640 (GRCm39) missense probably damaging 0.98
R7354:Hmcn1 UTSW 1 150,682,196 (GRCm39) nonsense probably null
R7360:Hmcn1 UTSW 1 150,494,597 (GRCm39) missense probably damaging 1.00
R7396:Hmcn1 UTSW 1 150,439,382 (GRCm39) missense possibly damaging 0.83
R7398:Hmcn1 UTSW 1 150,522,421 (GRCm39) missense probably benign 0.00
R7400:Hmcn1 UTSW 1 150,550,181 (GRCm39) missense probably damaging 1.00
R7404:Hmcn1 UTSW 1 150,596,510 (GRCm39) missense probably benign 0.00
R7424:Hmcn1 UTSW 1 150,506,017 (GRCm39) nonsense probably null
R7454:Hmcn1 UTSW 1 150,439,355 (GRCm39) missense probably damaging 1.00
R7476:Hmcn1 UTSW 1 150,456,018 (GRCm39) missense probably damaging 0.99
R7480:Hmcn1 UTSW 1 150,552,985 (GRCm39) critical splice donor site probably null
R7516:Hmcn1 UTSW 1 150,498,718 (GRCm39) missense probably benign 0.35
R7526:Hmcn1 UTSW 1 150,532,324 (GRCm39) missense probably damaging 1.00
R7531:Hmcn1 UTSW 1 150,562,531 (GRCm39) missense probably benign 0.06
R7555:Hmcn1 UTSW 1 150,480,625 (GRCm39) missense probably benign 0.40
R7564:Hmcn1 UTSW 1 150,531,586 (GRCm39) missense probably benign
R7588:Hmcn1 UTSW 1 150,532,885 (GRCm39) missense possibly damaging 0.90
R7719:Hmcn1 UTSW 1 150,441,080 (GRCm39) missense possibly damaging 0.95
R7720:Hmcn1 UTSW 1 150,522,460 (GRCm39) missense probably benign 0.00
R7722:Hmcn1 UTSW 1 150,543,631 (GRCm39) missense probably damaging 0.98
R7761:Hmcn1 UTSW 1 150,598,196 (GRCm39) missense possibly damaging 0.70
R7787:Hmcn1 UTSW 1 150,632,343 (GRCm39) missense probably damaging 1.00
R7803:Hmcn1 UTSW 1 150,646,030 (GRCm39) missense probably benign 0.32
R7862:Hmcn1 UTSW 1 150,682,172 (GRCm39) missense probably damaging 0.96
R7876:Hmcn1 UTSW 1 150,620,722 (GRCm39) missense probably benign 0.03
R7886:Hmcn1 UTSW 1 150,533,221 (GRCm39) missense possibly damaging 0.94
R7891:Hmcn1 UTSW 1 150,468,940 (GRCm39) missense probably damaging 1.00
R7892:Hmcn1 UTSW 1 150,540,643 (GRCm39) missense probably benign 0.00
R7927:Hmcn1 UTSW 1 150,485,526 (GRCm39) missense probably damaging 1.00
R7941:Hmcn1 UTSW 1 150,525,835 (GRCm39) missense possibly damaging 0.95
R7960:Hmcn1 UTSW 1 150,531,606 (GRCm39) missense probably damaging 1.00
R8001:Hmcn1 UTSW 1 150,540,629 (GRCm39) nonsense probably null
R8015:Hmcn1 UTSW 1 150,474,062 (GRCm39) missense possibly damaging 0.83
R8070:Hmcn1 UTSW 1 150,525,743 (GRCm39) nonsense probably null
R8072:Hmcn1 UTSW 1 150,532,256 (GRCm39) missense possibly damaging 0.62
R8113:Hmcn1 UTSW 1 150,624,841 (GRCm39) missense possibly damaging 0.50
R8143:Hmcn1 UTSW 1 150,734,957 (GRCm39) missense probably benign 0.03
R8145:Hmcn1 UTSW 1 150,629,411 (GRCm39) missense probably benign 0.33
R8155:Hmcn1 UTSW 1 150,480,705 (GRCm39) missense probably damaging 1.00
R8165:Hmcn1 UTSW 1 150,522,409 (GRCm39) missense probably benign 0.09
R8179:Hmcn1 UTSW 1 150,598,265 (GRCm39) missense probably benign 0.19
R8193:Hmcn1 UTSW 1 150,453,228 (GRCm39) nonsense probably null
R8234:Hmcn1 UTSW 1 150,469,761 (GRCm39) missense possibly damaging 0.83
R8249:Hmcn1 UTSW 1 150,695,117 (GRCm39) missense probably benign 0.24
R8267:Hmcn1 UTSW 1 150,735,005 (GRCm39) missense probably damaging 1.00
R8312:Hmcn1 UTSW 1 150,614,515 (GRCm39) missense probably damaging 0.99
R8338:Hmcn1 UTSW 1 150,614,485 (GRCm39) missense probably benign 0.35
R8354:Hmcn1 UTSW 1 150,634,142 (GRCm39) missense possibly damaging 0.79
R8440:Hmcn1 UTSW 1 150,570,671 (GRCm39) missense probably damaging 1.00
R8473:Hmcn1 UTSW 1 150,479,551 (GRCm39) missense possibly damaging 0.64
R8497:Hmcn1 UTSW 1 150,455,990 (GRCm39) missense probably benign 0.01
R8509:Hmcn1 UTSW 1 150,449,302 (GRCm39) nonsense probably null
R8559:Hmcn1 UTSW 1 150,551,789 (GRCm39) missense probably benign 0.25
R8701:Hmcn1 UTSW 1 150,631,008 (GRCm39) missense probably benign 0.00
R8755:Hmcn1 UTSW 1 150,509,371 (GRCm39) missense probably benign 0.19
R8765:Hmcn1 UTSW 1 150,556,413 (GRCm39) missense probably damaging 0.98
R8782:Hmcn1 UTSW 1 150,540,636 (GRCm39) missense probably benign 0.08
R8794:Hmcn1 UTSW 1 150,591,469 (GRCm39) missense probably benign 0.00
R8803:Hmcn1 UTSW 1 150,610,248 (GRCm39) missense probably damaging 1.00
R8808:Hmcn1 UTSW 1 150,531,570 (GRCm39) missense possibly damaging 0.64
R8853:Hmcn1 UTSW 1 150,547,726 (GRCm39) missense probably damaging 1.00
R8877:Hmcn1 UTSW 1 150,514,659 (GRCm39) missense probably benign 0.00
R8881:Hmcn1 UTSW 1 150,525,723 (GRCm39) missense probably damaging 1.00
R8916:Hmcn1 UTSW 1 150,649,530 (GRCm39) missense probably damaging 1.00
R9008:Hmcn1 UTSW 1 150,630,795 (GRCm39) intron probably benign
R9030:Hmcn1 UTSW 1 150,692,870 (GRCm39) missense probably benign 0.00
R9072:Hmcn1 UTSW 1 150,565,320 (GRCm39) missense probably benign 0.04
R9090:Hmcn1 UTSW 1 150,632,309 (GRCm39) missense probably damaging 1.00
R9096:Hmcn1 UTSW 1 150,532,869 (GRCm39) missense probably benign 0.04
R9102:Hmcn1 UTSW 1 150,573,331 (GRCm39) missense probably benign 0.01
R9146:Hmcn1 UTSW 1 150,474,141 (GRCm39) missense probably benign 0.02
R9157:Hmcn1 UTSW 1 150,522,343 (GRCm39) missense probably benign 0.06
R9169:Hmcn1 UTSW 1 150,506,092 (GRCm39) missense probably damaging 0.99
R9182:Hmcn1 UTSW 1 150,488,405 (GRCm39) missense probably damaging 1.00
R9182:Hmcn1 UTSW 1 150,500,337 (GRCm39) nonsense probably null
R9204:Hmcn1 UTSW 1 150,610,262 (GRCm39) missense probably benign 0.40
R9219:Hmcn1 UTSW 1 150,594,844 (GRCm39) critical splice donor site probably null
R9267:Hmcn1 UTSW 1 150,473,740 (GRCm39) missense probably benign 0.26
R9271:Hmcn1 UTSW 1 150,632,309 (GRCm39) missense probably damaging 1.00
R9274:Hmcn1 UTSW 1 150,506,046 (GRCm39) missense probably benign 0.01
R9313:Hmcn1 UTSW 1 150,522,343 (GRCm39) missense probably benign 0.06
R9414:Hmcn1 UTSW 1 150,545,187 (GRCm39) missense probably damaging 1.00
R9456:Hmcn1 UTSW 1 150,506,053 (GRCm39) nonsense probably null
R9464:Hmcn1 UTSW 1 150,599,248 (GRCm39) missense possibly damaging 0.80
R9474:Hmcn1 UTSW 1 150,506,471 (GRCm39) missense probably damaging 1.00
R9476:Hmcn1 UTSW 1 150,462,127 (GRCm39) missense probably benign 0.00
R9482:Hmcn1 UTSW 1 150,610,281 (GRCm39) missense probably benign 0.06
R9496:Hmcn1 UTSW 1 150,579,971 (GRCm39) missense probably benign 0.00
R9501:Hmcn1 UTSW 1 150,470,990 (GRCm39) missense possibly damaging 0.67
R9510:Hmcn1 UTSW 1 150,462,127 (GRCm39) missense probably benign 0.00
R9529:Hmcn1 UTSW 1 150,545,175 (GRCm39) missense probably damaging 1.00
R9566:Hmcn1 UTSW 1 150,498,660 (GRCm39) missense probably benign 0.00
R9608:Hmcn1 UTSW 1 150,475,303 (GRCm39) missense probably damaging 1.00
R9609:Hmcn1 UTSW 1 150,555,346 (GRCm39) missense probably damaging 0.96
R9616:Hmcn1 UTSW 1 150,684,473 (GRCm39) missense probably benign 0.16
R9627:Hmcn1 UTSW 1 150,506,054 (GRCm39) missense probably damaging 1.00
R9668:Hmcn1 UTSW 1 150,619,492 (GRCm39) missense probably benign 0.02
R9686:Hmcn1 UTSW 1 150,613,356 (GRCm39) missense probably damaging 0.99
R9717:Hmcn1 UTSW 1 150,485,378 (GRCm39) missense probably damaging 1.00
R9727:Hmcn1 UTSW 1 150,674,566 (GRCm39) missense probably benign 0.06
R9744:Hmcn1 UTSW 1 150,623,941 (GRCm39) missense probably damaging 1.00
R9749:Hmcn1 UTSW 1 150,632,339 (GRCm39) missense possibly damaging 0.94
R9761:Hmcn1 UTSW 1 150,868,625 (GRCm39) missense probably damaging 0.98
R9783:Hmcn1 UTSW 1 150,598,380 (GRCm39) missense probably benign 0.16
R9788:Hmcn1 UTSW 1 150,528,333 (GRCm39) missense probably benign 0.00
R9792:Hmcn1 UTSW 1 150,608,689 (GRCm39) missense possibly damaging 0.94
R9793:Hmcn1 UTSW 1 150,608,689 (GRCm39) missense possibly damaging 0.94
R9795:Hmcn1 UTSW 1 150,608,689 (GRCm39) missense possibly damaging 0.94
R9802:Hmcn1 UTSW 1 150,684,391 (GRCm39) missense probably benign 0.07
RF003:Hmcn1 UTSW 1 150,500,312 (GRCm39) missense probably damaging 1.00
RF005:Hmcn1 UTSW 1 150,510,897 (GRCm39) nonsense probably null
X0022:Hmcn1 UTSW 1 150,576,281 (GRCm39) missense probably benign 0.04
X0027:Hmcn1 UTSW 1 150,736,127 (GRCm39) missense probably damaging 1.00
X0028:Hmcn1 UTSW 1 150,539,652 (GRCm39) missense probably damaging 1.00
Z1088:Hmcn1 UTSW 1 150,524,688 (GRCm39) missense probably damaging 1.00
Z1176:Hmcn1 UTSW 1 150,539,668 (GRCm39) missense probably benign 0.12
Z1176:Hmcn1 UTSW 1 150,531,672 (GRCm39) missense possibly damaging 0.65
Z1176:Hmcn1 UTSW 1 150,462,196 (GRCm39) missense probably null 0.92
Predicted Primers PCR Primer
(F):5'- CCAAGAGGGCACAGTCAGCATTT -3'
(R):5'- CACACATCCTTTGGCTTCTGTGACA -3'

Sequencing Primer
(F):5'- GGCACAGTCAGCATTTTAGAC -3'
(R):5'- GGCTTCTGTGACATCATTGG -3'
Posted On 2013-06-11