Mutagenetix > Incidental Mutations

Incidental Mutation 'IGL03134:Cacna1a'

453169

Institutional Source

Beutler Lab

Gene Symbol

Cacna1a

Ensembl Gene

ENSMUSG00000034656

Gene Name

calcium channel, voltage-dependent, P/Q type, alpha 1A subunit

Synonyms

Cacnl1a4, alpha1A, SCA6, nmf352, Ccha1a

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.929) question?

Stock #

IGL03134 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

84388440-84640246 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 84559087 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Arginine at position 740 (Q740R)

Ref Sequence

ENSEMBL: ENSMUSP00000114055 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000121390] [ENSMUST00000122053]

Predicted Effect

probably benign
Transcript: ENSMUST00000121390
AA Change: Q787R

PolyPhen 2 Score 0.323 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000112436
Gene: ENSMUSG00000034656
AA Change: Q787R

Domain	Start	End	E-Value	Type
low complexity region	9	47	N/A	INTRINSIC
Pfam:Ion_trans	99	373	1.5e-69	PFAM
Pfam:Ion_trans	488	727	1.2e-54	PFAM
Pfam:PKD_channel	578	721	6.6e-8	PFAM
low complexity region	920	959	N/A	INTRINSIC
low complexity region	977	987	N/A	INTRINSIC
low complexity region	1074	1093	N/A	INTRINSIC
low complexity region	1143	1168	N/A	INTRINSIC
Pfam:Ion_trans	1194	1472	4.9e-64	PFAM
Pfam:Ion_trans	1516	1773	2.8e-64	PFAM
Pfam:GPHH	1775	1844	5.6e-39	PFAM
Ca_chan_IQ	1899	1933	1.8e-12	SMART
AT_hook	2053	2065	2.02e0	SMART
low complexity region	2101	2113	N/A	INTRINSIC
low complexity region	2153	2179	N/A	INTRINSIC
low complexity region	2213	2236	N/A	INTRINSIC
low complexity region	2253	2282	N/A	INTRINSIC
low complexity region	2314	2325	N/A	INTRINSIC
low complexity region	2342	2357	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000122053
AA Change: Q740R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000114055
Gene: ENSMUSG00000034656
AA Change: Q740R

Domain	Start	End	E-Value	Type
low complexity region	9	47	N/A	INTRINSIC
Pfam:Ion_trans	91	314	4.5e-58	PFAM
PDB:4DEX\|B	317	427	5e-45	PDB
Pfam:Ion_trans	476	668	6.4e-46	PFAM
Pfam:PKD_channel	530	675	7.7e-8	PFAM
low complexity region	873	912	N/A	INTRINSIC
low complexity region	930	940	N/A	INTRINSIC
low complexity region	1027	1046	N/A	INTRINSIC
low complexity region	1096	1121	N/A	INTRINSIC
Pfam:Ion_trans	1183	1414	2.8e-54	PFAM
Pfam:Ion_trans	1504	1714	3.2e-60	PFAM
Ca_chan_IQ	1852	1886	1.8e-12	SMART
AT_hook	2006	2018	2.02e0	SMART
low complexity region	2054	2066	N/A	INTRINSIC
low complexity region	2106	2132	N/A	INTRINSIC
low complexity region	2166	2189	N/A	INTRINSIC
low complexity region	2206	2235	N/A	INTRINSIC
low complexity region	2267	2278	N/A	INTRINSIC
low complexity region	2295	2310	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000215756
AA Change: Q739R

Meta Mutation Damage Score

0.0623

Coding Region Coverage

1x: 0.0%
3x: 0.0%
10x: 0.0%
20x: 0.0%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-dependent calcium channels mediate the entry of calcium ions into excitable cells, and are also involved in a variety of calcium-dependent processes, including muscle contraction, hormone or neurotransmitter release, and gene expression. Calcium channels are multisubunit complexes composed of alpha-1, beta, alpha-2/delta, and gamma subunits. The channel activity is directed by the pore-forming alpha-1 subunit, whereas, the others act as auxiliary subunits regulating this activity. The distinctive properties of the calcium channel types are related primarily to the expression of a variety of alpha-1 isoforms, alpha-1A, B, C, D, E, and S. This gene encodes the alpha-1A subunit, which is predominantly expressed in neuronal tissue. Mutations in this gene are associated with 2 neurologic disorders, familial hemiplegic migraine and episodic ataxia 2. This gene also exhibits polymorphic variation due to (CAG)n-repeats. Multiple transcript variants encoding different isoforms have been found for this gene. In one set of transcript variants, the (CAG)n-repeats occur in the 3' UTR, and are not associated with any disease. But in another set of variants, an insertion extends the coding region to include the (CAG)n-repeats which encode a polyglutamine tract. Expansion of the (CAG)n-repeats from the normal 4-18 to 21-33 in the coding region is associated with spinocerebellar ataxia 6. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for different mutant alleles are characterized by variably severe wobbly gait beginning prior to weaning, ataxia, episodic dyskinesia, cerebellar atrophy, and absence epilepsy. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414J04Rik	A	T	11: 21,507,249		noncoding transcript	Het
4933416I08Rik	TCC	TCCC	X: 53,690,895		noncoding transcript	Het
Afdn	C	T	17: 13,846,286	T580I	probably benign	Het
Ankfy1	G	T	11: 72,712,185	L13F	probably damaging	Het
Arhgap12	T	C	18: 6,111,936	T143A	probably benign	Het
Arsi	T	G	18: 60,917,352	W436G	probably damaging	Het
Bcl2l10	C	T	9: 75,348,198	T99M	probably damaging	Het
C77080	A	G	4: 129,222,487	S783P	possibly damaging	Het
Cacna1g	A	G	11: 94,459,825	F398S	probably damaging	Het
Ccrl2	A	C	9: 111,055,657	Y258D	probably damaging	Het
Cemip	T	A	7: 83,999,237	D38V	probably damaging	Het
Chd6	C	G	2: 160,965,483	C1937S	possibly damaging	Het
Cilp	TGGG	TGG	9: 65,280,130		probably null	Het
Col1a2	T	G	6: 4,521,387		probably benign	Het
Col4a1	T	C	8: 11,240,069		probably null	Het
Cops7b	T	A	1: 86,592,334	L69Q	probably damaging	Het
Crb1	CG	C	1: 139,237,086		probably null	Het
Ddx3y	T	A	Y: 1,278,949	D163V	possibly damaging	Het
Dnajc19	A	G	3: 34,078,735		probably benign	Het
Fam160b2	T	C	14: 70,588,709	T288A	possibly damaging	Het
G2e3	T	A	12: 51,364,030		probably benign	Het
Gimap7	A	G	6: 48,723,501	N7S	probably benign	Het
Gkap1	G	A	13: 58,263,932		probably benign	Het
Gm3404	G	A	5: 146,526,896	R117Q	probably benign	Het
Herc1	T	TN	9: 66,434,063		probably benign	Homo
Homer3	T	C	8: 70,286,335	Y115H	probably benign	Het
Ighv10-1	T	A	12: 114,479,069	M99L	probably benign	Het
Kdm2b	A	C	5: 122,932,674	S398R	probably damaging	Het
Lyl1	C	T	8: 84,702,671	P3L	possibly damaging	Het
Mettl25	G	A	10: 105,826,027	Q361*	probably null	Het
Mkrn2	T	A	6: 115,613,535	I284N	probably damaging	Het
Mmp14	T	A	14: 54,439,106	N369K	probably damaging	Het
Mmp1a	TG	TGG	9: 7,465,083		probably null	Het
Myo6	C	G	9: 80,292,467	N1019K	probably damaging	Het
Myo7a	C	T	7: 98,056,767	V1857I	probably damaging	Het
Nktr	T	C	9: 121,746,466	S347P	probably damaging	Het
Nup210	T	G	6: 91,030,190	D548A	probably damaging	Het
Nup210l	A	G	3: 90,190,887	Y1382C	possibly damaging	Het
Olfr295	G	A	7: 86,586,012	V246M	probably damaging	Het
Olfr382	T	A	11: 73,517,115	Y28F	probably benign	Het
Pax8	T	C	2: 24,421,391		probably benign	Het
Pcdhgb7	A	G	18: 37,751,882	Y35C	probably damaging	Het
Pld1	A	T	3: 28,029,167	R145S	probably benign	Het
Pom121	G	A	5: 135,382,081	P741S	unknown	Het
Rarb	T	C	14: 16,436,910	N204D	probably damaging	Het
Sdc3	A	G	4: 130,821,504	E337G	probably benign	Het
Serpina9	T	C	12: 104,001,437	K233R	probably null	Het
Speer4c	A	C	5: 15,714,216		probably benign	Het
Sspo	T	A	6: 48,451,065	M159K	probably benign	Het
Stxbp4	C	A	11: 90,607,184	R96S	probably damaging	Het
Tg	A	C	15: 66,740,718	E375A	probably damaging	Het
Tmem176b	A	G	6: 48,838,353	V2A	probably benign	Het
Toporsl	G	A	4: 52,610,281	C58Y	probably damaging	Het
Ugt1a1	AT	A	1: 88,212,371		probably null	Het
Vav3	T	C	3: 109,563,094		probably benign	Het
Zfp180	T	A	7: 24,104,745	D196E	possibly damaging	Het
Zfp407	C	T	18: 84,209,955	S1843N	probably damaging	Het

Other mutations in Cacna1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00507:Cacna1a	APN	8	84571208	nonsense	probably null
IGL00513:Cacna1a	APN	8	84553056	missense	probably damaging	1.00
IGL00569:Cacna1a	APN	8	84462714	missense	probably damaging	1.00
IGL00981:Cacna1a	APN	8	84548553	missense	probably damaging	1.00
IGL01122:Cacna1a	APN	8	84614793	critical splice donor site	probably null
IGL01309:Cacna1a	APN	8	84523028	missense	probably damaging	1.00
IGL01380:Cacna1a	APN	8	84559117	missense	probably damaging	1.00
IGL01638:Cacna1a	APN	8	84571827	missense	probably damaging	0.98
IGL01682:Cacna1a	APN	8	84536438	missense	possibly damaging	0.71
IGL02751:Cacna1a	APN	8	84569952	missense	probably damaging	1.00
IGL02904:Cacna1a	APN	8	84579520	missense	probably damaging	1.00
IGL03122:Cacna1a	APN	8	84462676	splice site	probably benign
totter	UTSW	8	84588753	missense	probably damaging	0.99
totter2	UTSW	8	84588753	missense	probably damaging	0.99
FR4340:Cacna1a	UTSW	8	84638723	small insertion	probably benign
FR4449:Cacna1a	UTSW	8	84638714	small insertion	probably benign
FR4449:Cacna1a	UTSW	8	84638720	small insertion	probably benign
FR4449:Cacna1a	UTSW	8	84638723	small insertion	probably benign
FR4548:Cacna1a	UTSW	8	84638717	small insertion	probably benign
FR4737:Cacna1a	UTSW	8	84638720	small insertion	probably benign
FR4737:Cacna1a	UTSW	8	84638726	small insertion	probably benign
FR4976:Cacna1a	UTSW	8	84638717	small insertion	probably benign
FR4976:Cacna1a	UTSW	8	84638726	small insertion	probably benign
R0055:Cacna1a	UTSW	8	84580058	splice site	probably benign
R0118:Cacna1a	UTSW	8	84536083	missense	probably damaging	1.00
R0284:Cacna1a	UTSW	8	84612285	missense	probably damaging	1.00
R0581:Cacna1a	UTSW	8	84601936	missense	possibly damaging	0.83
R0607:Cacna1a	UTSW	8	84629831	missense	probably damaging	1.00
R1168:Cacna1a	UTSW	8	84579501	missense	probably damaging	1.00
R1183:Cacna1a	UTSW	8	84580217	missense	probably damaging	1.00
R1470:Cacna1a	UTSW	8	84514950	splice site	probably benign
R1503:Cacna1a	UTSW	8	84601946	missense	probably benign	0.23
R1522:Cacna1a	UTSW	8	84633433	missense	probably benign	0.00
R1835:Cacna1a	UTSW	8	84581357	splice site	probably null
R1862:Cacna1a	UTSW	8	84415930	missense	possibly damaging	0.80
R2148:Cacna1a	UTSW	8	84629675	missense	possibly damaging	0.71
R2237:Cacna1a	UTSW	8	84633765	critical splice donor site	probably null
R2567:Cacna1a	UTSW	8	84549725	missense	probably damaging	1.00
R2999:Cacna1a	UTSW	8	84567742	missense	probably damaging	1.00
R3025:Cacna1a	UTSW	8	84580225	critical splice donor site	probably null
R3610:Cacna1a	UTSW	8	84559065	missense	probably damaging	1.00
R3702:Cacna1a	UTSW	8	84617846	missense	probably damaging	0.98
R3763:Cacna1a	UTSW	8	84583642	missense	possibly damaging	0.85
R4025:Cacna1a	UTSW	8	84581333	missense	probably damaging	1.00
R4026:Cacna1a	UTSW	8	84581333	missense	probably damaging	1.00
R4106:Cacna1a	UTSW	8	84583695	missense	possibly damaging	0.85
R4296:Cacna1a	UTSW	8	84559293	missense	probably damaging	1.00
R4664:Cacna1a	UTSW	8	84601767	nonsense	probably null
R4713:Cacna1a	UTSW	8	84549514	missense	probably damaging	1.00
R5223:Cacna1a	UTSW	8	84587195	missense	possibly damaging	0.94
R5408:Cacna1a	UTSW	8	84549707	missense	probably damaging	1.00
R5644:Cacna1a	UTSW	8	84462777	missense	probably damaging	1.00
R5734:Cacna1a	UTSW	8	84583731	missense	probably damaging	0.96
R5786:Cacna1a	UTSW	8	84415721	unclassified	probably benign
R5833:Cacna1a	UTSW	8	84518697	missense	probably damaging	1.00
R5886:Cacna1a	UTSW	8	84523022	missense	probably damaging	0.99
R6049:Cacna1a	UTSW	8	84638846	missense	probably damaging	0.96
R6054:Cacna1a	UTSW	8	84556785	missense	probably damaging	0.99
R6117:Cacna1a	UTSW	8	84614721	missense	probably damaging	1.00
R6149:Cacna1a	UTSW	8	84569952	missense	probably damaging	1.00
R6195:Cacna1a	UTSW	8	84588753	missense	probably damaging	0.99
R6233:Cacna1a	UTSW	8	84588753	missense	probably damaging	0.99
R6607:Cacna1a	UTSW	8	84579492	missense	probably damaging	1.00
R6753:Cacna1a	UTSW	8	84580205	missense	probably damaging	1.00
R6798:Cacna1a	UTSW	8	84611602	missense	probably damaging	1.00
R6831:Cacna1a	UTSW	8	84571231	missense	probably damaging	1.00
R6980:Cacna1a	UTSW	8	84612285	missense	possibly damaging	0.85
R7051:Cacna1a	UTSW	8	84629915	missense	possibly damaging	0.85
R7270:Cacna1a	UTSW	8	84571237	missense	probably damaging	1.00
R7409:Cacna1a	UTSW	8	84533402	missense	probably damaging	1.00
R7491:Cacna1a	UTSW	8	84559293	missense	possibly damaging	0.92
R7511:Cacna1a	UTSW	8	84567682	missense	possibly damaging	0.75
R7745:Cacna1a	UTSW	8	84559394	missense	probably benign	0.01
RF029:Cacna1a	UTSW	8	84638724	small insertion	probably benign
X0022:Cacna1a	UTSW	8	84633699	missense	possibly damaging	0.53

Predicted Primers

PCR Primer
(F):5'- AGAATCCACTGGAGTTGCGG -3'
(R):5'- ACTCACTTTCTGCGTCGGTG -3'

Sequencing Primer
(F):5'- ACCTTCGTTATCCGACCA -3'
(R):5'- ATACGGGCCCTCTCGTC -3'

Posted On

2017-01-30