Incidental Mutation 'R0554:Adcy10'
ID 45318
Institutional Source Beutler Lab
Gene Symbol Adcy10
Ensembl Gene ENSMUSG00000026567
Gene Name adenylate cyclase 10
Synonyms soluble adenylyl cyclase, Sacy, 4930431D04Rik, sAC
MMRRC Submission 038746-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.255) question?
Stock # R0554 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 165312752-165404343 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 165340699 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Serine at position 235 (G235S)
Ref Sequence ENSEMBL: ENSMUSP00000137959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027852] [ENSMUST00000111439] [ENSMUST00000111440] [ENSMUST00000148550] [ENSMUST00000155216]
AlphaFold Q8C0T9
Predicted Effect probably benign
Transcript: ENSMUST00000027852
AA Change: G235S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027852
Gene: ENSMUSG00000026567
AA Change: G235S

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 285 442 2.3e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 6e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000111439
AA Change: G235S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107066
Gene: ENSMUSG00000026567
AA Change: G235S

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 286 420 1.9e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 7e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000111440
AA Change: G235S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107067
Gene: ENSMUSG00000026567
AA Change: G235S

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 286 420 1.9e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 7e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000148550
AA Change: G235S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137959
Gene: ENSMUSG00000026567
AA Change: G235S

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 285 420 4.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155216
SMART Domains Protein: ENSMUSP00000137744
Gene: ENSMUSG00000026567

DomainStartEndE-ValueType
PDB:4OZ3|A 1 98 2e-51 PDB
Blast:CYCc 7 98 2e-61 BLAST
SCOP:d1azsb_ 43 98 9e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194554
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195194
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a distinct class of adenylyl cyclases that is soluble and insensitive to G protein or forskolin regulation. Activity of this protein is regulated by bicarbonate. Variation at this gene has been observed in patients with absorptive hypercalciuria. Alternatively spliced transcript variants encoding different isoforms have been observed. There is a pseudogene of this gene on chromosome 6. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null male mutants are infertile with a severe sperm motility defect, female null mutants are fertile. Females exhibit increased cholesterol and triglyceride levels while both sexes have a slight increase in heart rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T A 5: 144,982,181 (GRCm39) Y255* probably null Het
1810024B03Rik A G 2: 127,029,196 (GRCm39) M1T probably null Het
4930503L19Rik T C 18: 70,600,451 (GRCm39) D386G probably damaging Het
Ace2 T A X: 162,958,947 (GRCm39) N601K probably benign Het
Adam4 A C 12: 81,468,198 (GRCm39) I141R probably damaging Het
Adcy5 G A 16: 35,114,387 (GRCm39) V997I probably benign Het
Aff2 T G X: 68,907,680 (GRCm39) W1221G possibly damaging Het
Ankrd44 T C 1: 54,802,917 (GRCm39) N194D probably benign Het
Apba2 T G 7: 64,395,528 (GRCm39) L668R probably damaging Het
Asph T C 4: 9,604,581 (GRCm39) D152G probably damaging Het
Bcl3 C G 7: 19,553,991 (GRCm39) V126L probably benign Het
Cd163 A G 6: 124,289,619 (GRCm39) T446A probably benign Het
Cd209g C T 8: 4,184,995 (GRCm39) probably benign Het
Cdadc1 A T 14: 59,823,901 (GRCm39) V197E probably damaging Het
CN725425 T C 15: 91,144,966 (GRCm39) C610R possibly damaging Het
Col6a2 A G 10: 76,446,995 (GRCm39) probably null Het
Coro7 A G 16: 4,450,121 (GRCm39) L576P possibly damaging Het
Dgkb T A 12: 38,266,030 (GRCm39) V503E probably benign Het
Dhx57 A T 17: 80,567,665 (GRCm39) L806* probably null Het
Dlec1 T C 9: 118,944,070 (GRCm39) V373A probably benign Het
Dnah11 G T 12: 117,894,913 (GRCm39) R3645S probably benign Het
Dnhd1 T C 7: 105,343,602 (GRCm39) S1649P probably benign Het
Draxin T G 4: 148,192,420 (GRCm39) K297N probably damaging Het
Epha7 T C 4: 28,951,401 (GRCm39) S841P probably damaging Het
Esp8 T G 17: 40,841,166 (GRCm39) D142E unknown Het
F5 T G 1: 164,007,018 (GRCm39) V274G probably damaging Het
Fancc T C 13: 63,465,283 (GRCm39) S475G probably benign Het
Fmo3 T C 1: 162,781,901 (GRCm39) N484S probably benign Het
Focad T C 4: 88,267,126 (GRCm39) Y1046H unknown Het
Furin C T 7: 80,041,032 (GRCm39) G602D probably damaging Het
Fut8 A T 12: 77,411,744 (GRCm39) I69L probably benign Het
Gnai3 A G 3: 108,030,928 (GRCm39) I78T probably benign Het
Gpr182 T C 10: 127,586,940 (GRCm39) I4V probably benign Het
Gpr63 T C 4: 25,007,447 (GRCm39) M57T probably benign Het
Grm1 T A 10: 10,595,667 (GRCm39) T654S probably benign Het
Gtf2h4 T C 17: 35,979,531 (GRCm39) T371A probably benign Het
Helq T C 5: 100,938,066 (GRCm39) N460S probably benign Het
Hmcn1 T C 1: 150,594,868 (GRCm39) N1867S probably benign Het
Hsh2d G A 8: 72,954,304 (GRCm39) D229N probably benign Het
Iigp1c G A 18: 60,378,489 (GRCm39) R8H probably benign Het
Inpp5j A G 11: 3,449,644 (GRCm39) Y713H probably damaging Het
Ints6 A T 14: 62,942,200 (GRCm39) V511D possibly damaging Het
Irag2 G A 6: 145,111,013 (GRCm39) A237T probably benign Het
Itga4 A G 2: 79,109,461 (GRCm39) Y220C probably damaging Het
Itgav T G 2: 83,624,614 (GRCm39) S735A possibly damaging Het
Kctd16 A G 18: 40,391,492 (GRCm39) I27V probably benign Het
Klhl6 T C 16: 19,772,343 (GRCm39) E334G probably damaging Het
Ltbp1 T A 17: 75,532,274 (GRCm39) L116H probably damaging Het
Magohb T A 6: 131,262,660 (GRCm39) H98L probably benign Het
Mgat2 A G 12: 69,232,166 (GRCm39) T247A probably benign Het
Mtif2 G A 11: 29,483,398 (GRCm39) probably null Het
Myrfl T C 10: 116,664,878 (GRCm39) E384G probably damaging Het
Nfam1 G T 15: 82,917,410 (GRCm39) R8S probably benign Het
Numa1 T C 7: 101,644,731 (GRCm39) S236P possibly damaging Het
Or14c46 A T 7: 85,918,865 (GRCm39) I44N probably damaging Het
Or2w3b T C 11: 58,623,865 (GRCm39) N42S probably damaging Het
Or5m10b T C 2: 85,699,863 (GRCm39) F309S probably benign Het
Or6c207 T C 10: 129,104,368 (GRCm39) T275A probably benign Het
Orc4 C T 2: 48,795,433 (GRCm39) S431N probably benign Het
Pax2 T C 19: 44,750,300 (GRCm39) V129A probably damaging Het
Pcdhb15 A G 18: 37,607,572 (GRCm39) D268G probably damaging Het
Pdcd1 G A 1: 93,967,107 (GRCm39) R264C probably damaging Het
Pi15 T A 1: 17,691,872 (GRCm39) M187K probably benign Het
Plag1 C T 4: 3,904,546 (GRCm39) C215Y probably damaging Het
Plagl1 A G 10: 13,002,926 (GRCm39) T65A probably benign Het
Pramel51 T C 12: 88,144,328 (GRCm39) T162A probably benign Het
Prss48 T A 3: 85,908,228 (GRCm39) Q18L probably benign Het
Prune2 T A 19: 17,102,582 (GRCm39) C2580* probably null Het
Rab40b T A 11: 121,250,432 (GRCm39) Q74L probably damaging Het
Raf1 A G 6: 115,600,491 (GRCm39) I376T probably benign Het
Rbm46 A T 3: 82,772,575 (GRCm39) F186I probably damaging Het
Reps1 C T 10: 17,998,867 (GRCm39) T720M possibly damaging Het
Rgs22 A G 15: 36,054,855 (GRCm39) M649T probably benign Het
Rhot1 C T 11: 80,134,264 (GRCm39) R47* probably null Het
Rhox2f A G X: 36,753,124 (GRCm39) Y8C possibly damaging Het
Rnf17 A G 14: 56,760,007 (GRCm39) Y1604C probably damaging Het
Rnf40 T C 7: 127,201,756 (GRCm39) C943R probably damaging Het
Ropn1l A T 15: 31,451,295 (GRCm39) M63K probably benign Het
Sbf2 C A 7: 110,027,494 (GRCm39) V501F probably damaging Het
Sh3bp1 T A 15: 78,791,467 (GRCm39) M354K probably damaging Het
Sipa1l3 T C 7: 29,087,455 (GRCm39) H590R possibly damaging Het
Slco6d1 T A 1: 98,394,422 (GRCm39) C369S probably benign Het
Sulf1 T C 1: 12,875,418 (GRCm39) Y143H probably damaging Het
Tiam2 A T 17: 3,488,956 (GRCm39) R755* probably null Het
Trim12c C A 7: 103,994,169 (GRCm39) L228F probably damaging Het
Ttc23l G T 15: 10,530,743 (GRCm39) Q290K probably benign Het
Uba3 T C 6: 97,168,221 (GRCm39) probably null Het
Ugt1a10 A G 1: 87,983,817 (GRCm39) E205G probably damaging Het
Ugt3a1 T A 15: 9,351,206 (GRCm39) S72T probably benign Het
Upk3bl C T 5: 136,088,648 (GRCm39) T113I probably damaging Het
Uspl1 T A 5: 149,124,644 (GRCm39) D20E probably damaging Het
Vmn2r19 G A 6: 123,313,102 (GRCm39) G724E probably damaging Het
Vmn2r63 T A 7: 42,583,129 (GRCm39) K29* probably null Het
Vwf C T 6: 125,619,744 (GRCm39) A1474V probably benign Het
Xpc C T 6: 91,468,208 (GRCm39) A860T probably benign Het
Zfp462 A G 4: 55,013,689 (GRCm39) H737R probably damaging Het
Zfp536 T C 7: 37,180,244 (GRCm39) D787G probably damaging Het
Zfp692 A G 11: 58,205,053 (GRCm39) H434R probably damaging Het
Zp1 C A 19: 10,897,926 (GRCm39) C5F probably benign Het
Other mutations in Adcy10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Adcy10 APN 1 165,379,483 (GRCm39) missense probably benign 0.45
IGL00731:Adcy10 APN 1 165,400,183 (GRCm39) missense probably benign
IGL01099:Adcy10 APN 1 165,367,411 (GRCm39) missense probably benign 0.21
IGL01464:Adcy10 APN 1 165,374,156 (GRCm39) missense probably damaging 1.00
IGL01729:Adcy10 APN 1 165,340,737 (GRCm39) critical splice donor site probably null
IGL02002:Adcy10 APN 1 165,349,412 (GRCm39) missense probably damaging 1.00
IGL02094:Adcy10 APN 1 165,398,189 (GRCm39) missense probably damaging 1.00
IGL02132:Adcy10 APN 1 165,400,112 (GRCm39) missense probably damaging 0.96
IGL02276:Adcy10 APN 1 165,386,697 (GRCm39) missense probably damaging 0.96
IGL02408:Adcy10 APN 1 165,365,949 (GRCm39) missense probably damaging 1.00
IGL02410:Adcy10 APN 1 165,337,977 (GRCm39) missense probably damaging 1.00
IGL02445:Adcy10 APN 1 165,398,313 (GRCm39) missense possibly damaging 0.85
IGL02470:Adcy10 APN 1 165,395,295 (GRCm39) missense probably damaging 1.00
IGL02551:Adcy10 APN 1 165,370,802 (GRCm39) missense probably damaging 1.00
IGL02606:Adcy10 APN 1 165,347,087 (GRCm39) missense possibly damaging 0.88
IGL02609:Adcy10 APN 1 165,366,044 (GRCm39) nonsense probably null
Bugged UTSW 1 165,391,806 (GRCm39) missense probably damaging 0.99
debye UTSW 1 165,378,930 (GRCm39) critical splice donor site probably null
malaysian UTSW 1 165,340,696 (GRCm39) missense probably benign 0.38
singaporean UTSW 1 165,345,881 (GRCm39) missense probably damaging 0.98
PIT4514001:Adcy10 UTSW 1 165,384,360 (GRCm39) missense probably benign 0.28
R0046:Adcy10 UTSW 1 165,367,403 (GRCm39) missense probably damaging 0.99
R0046:Adcy10 UTSW 1 165,367,403 (GRCm39) missense probably damaging 0.99
R0276:Adcy10 UTSW 1 165,400,160 (GRCm39) missense possibly damaging 0.88
R0324:Adcy10 UTSW 1 165,391,818 (GRCm39) missense probably benign 0.00
R0433:Adcy10 UTSW 1 165,379,591 (GRCm39) missense probably damaging 1.00
R0454:Adcy10 UTSW 1 165,398,297 (GRCm39) missense probably damaging 1.00
R0501:Adcy10 UTSW 1 165,337,959 (GRCm39) missense probably damaging 1.00
R0513:Adcy10 UTSW 1 165,347,088 (GRCm39) missense probably benign 0.04
R0533:Adcy10 UTSW 1 165,391,592 (GRCm39) missense probably benign 0.05
R0550:Adcy10 UTSW 1 165,392,884 (GRCm39) missense probably benign 0.00
R0597:Adcy10 UTSW 1 165,352,631 (GRCm39) critical splice donor site probably null
R0629:Adcy10 UTSW 1 165,370,674 (GRCm39) missense probably damaging 1.00
R1421:Adcy10 UTSW 1 165,391,516 (GRCm39) missense probably damaging 0.98
R1454:Adcy10 UTSW 1 165,342,949 (GRCm39) missense possibly damaging 0.66
R1524:Adcy10 UTSW 1 165,345,972 (GRCm39) missense probably damaging 1.00
R1534:Adcy10 UTSW 1 165,345,881 (GRCm39) missense probably damaging 0.98
R1594:Adcy10 UTSW 1 165,352,602 (GRCm39) missense probably benign 0.02
R1690:Adcy10 UTSW 1 165,347,494 (GRCm39) missense probably damaging 1.00
R1842:Adcy10 UTSW 1 165,330,812 (GRCm39) missense probably damaging 1.00
R1859:Adcy10 UTSW 1 165,349,530 (GRCm39) missense probably damaging 1.00
R1885:Adcy10 UTSW 1 165,398,377 (GRCm39) missense probably benign 0.02
R1929:Adcy10 UTSW 1 165,337,866 (GRCm39) missense probably damaging 1.00
R2005:Adcy10 UTSW 1 165,352,591 (GRCm39) missense probably benign 0.02
R2211:Adcy10 UTSW 1 165,345,781 (GRCm39) missense probably damaging 1.00
R2225:Adcy10 UTSW 1 165,345,829 (GRCm39) missense probably damaging 1.00
R2227:Adcy10 UTSW 1 165,345,829 (GRCm39) missense probably damaging 1.00
R2272:Adcy10 UTSW 1 165,337,866 (GRCm39) missense probably damaging 1.00
R2421:Adcy10 UTSW 1 165,386,166 (GRCm39) missense probably damaging 0.97
R3614:Adcy10 UTSW 1 165,403,296 (GRCm39) missense probably benign 0.38
R4538:Adcy10 UTSW 1 165,340,696 (GRCm39) missense probably benign 0.38
R4644:Adcy10 UTSW 1 165,378,930 (GRCm39) critical splice donor site probably null
R4649:Adcy10 UTSW 1 165,331,618 (GRCm39) missense probably damaging 1.00
R4832:Adcy10 UTSW 1 165,334,213 (GRCm39) missense probably damaging 1.00
R4853:Adcy10 UTSW 1 165,375,782 (GRCm39) missense probably benign
R4916:Adcy10 UTSW 1 165,345,815 (GRCm39) missense probably damaging 1.00
R4951:Adcy10 UTSW 1 165,391,532 (GRCm39) missense probably damaging 1.00
R4972:Adcy10 UTSW 1 165,384,431 (GRCm39) missense probably damaging 1.00
R5116:Adcy10 UTSW 1 165,347,069 (GRCm39) missense probably damaging 1.00
R5377:Adcy10 UTSW 1 165,347,464 (GRCm39) missense probably damaging 1.00
R5442:Adcy10 UTSW 1 165,340,709 (GRCm39) missense probably benign 0.43
R5692:Adcy10 UTSW 1 165,342,875 (GRCm39) missense probably benign 0.36
R5949:Adcy10 UTSW 1 165,367,386 (GRCm39) missense possibly damaging 0.79
R5998:Adcy10 UTSW 1 165,369,218 (GRCm39) missense probably benign 0.19
R6238:Adcy10 UTSW 1 165,403,297 (GRCm39) nonsense probably null
R6455:Adcy10 UTSW 1 165,345,943 (GRCm39) missense probably damaging 1.00
R6920:Adcy10 UTSW 1 165,403,227 (GRCm39) missense probably damaging 1.00
R6935:Adcy10 UTSW 1 165,334,204 (GRCm39) missense probably benign 0.21
R6957:Adcy10 UTSW 1 165,391,854 (GRCm39) missense probably damaging 1.00
R6970:Adcy10 UTSW 1 165,384,485 (GRCm39) missense probably benign 0.02
R7027:Adcy10 UTSW 1 165,345,815 (GRCm39) missense probably damaging 1.00
R7049:Adcy10 UTSW 1 165,367,443 (GRCm39) missense probably damaging 1.00
R7062:Adcy10 UTSW 1 165,366,091 (GRCm39) missense probably benign 0.27
R7130:Adcy10 UTSW 1 165,331,616 (GRCm39) missense probably damaging 1.00
R7144:Adcy10 UTSW 1 165,337,939 (GRCm39) missense probably benign 0.01
R7182:Adcy10 UTSW 1 165,371,039 (GRCm39) splice site probably null
R7228:Adcy10 UTSW 1 165,337,841 (GRCm39) missense probably damaging 1.00
R7384:Adcy10 UTSW 1 165,404,177 (GRCm39) missense unknown
R7561:Adcy10 UTSW 1 165,386,741 (GRCm39) missense possibly damaging 0.94
R7603:Adcy10 UTSW 1 165,391,806 (GRCm39) missense probably damaging 0.99
R7693:Adcy10 UTSW 1 165,398,340 (GRCm39) missense probably benign 0.01
R7812:Adcy10 UTSW 1 165,342,938 (GRCm39) missense probably damaging 1.00
R7905:Adcy10 UTSW 1 165,340,737 (GRCm39) critical splice donor site probably null
R8040:Adcy10 UTSW 1 165,379,593 (GRCm39) missense probably damaging 1.00
R8242:Adcy10 UTSW 1 165,374,118 (GRCm39) missense possibly damaging 0.82
R8278:Adcy10 UTSW 1 165,330,857 (GRCm39) missense probably damaging 1.00
R8282:Adcy10 UTSW 1 165,337,906 (GRCm39) missense probably benign 0.34
R8812:Adcy10 UTSW 1 165,378,867 (GRCm39) missense probably damaging 0.98
R9039:Adcy10 UTSW 1 165,345,914 (GRCm39) missense probably damaging 1.00
R9178:Adcy10 UTSW 1 165,403,218 (GRCm39) missense possibly damaging 0.79
R9244:Adcy10 UTSW 1 165,370,679 (GRCm39) missense probably benign 0.00
R9712:Adcy10 UTSW 1 165,340,681 (GRCm39) missense probably damaging 1.00
RF018:Adcy10 UTSW 1 165,379,678 (GRCm39) missense probably damaging 1.00
Z1177:Adcy10 UTSW 1 165,337,845 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CCTGTACTAGACATACTGTTTGCAGGGA -3'
(R):5'- GGAGATTCAAGAACAGACATGGCACA -3'

Sequencing Primer
(F):5'- CAGGGAAATGATATTCCTAAGGTCAC -3'
(R):5'- ACCCGGCATTGTTCTGAAG -3'
Posted On 2013-06-11