Incidental Mutation 'IGL03134:Olfr382'
ID453180
Institutional Source Beutler Lab
Gene Symbol Olfr382
Ensembl Gene ENSMUSG00000095312
Gene Nameolfactory receptor 382
SynonymsMOR135-31_p, MOR135-14, GA_x6K02T2P1NL-3676608-3675670
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #IGL03134 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location73516259-73517197 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73517115 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 28 (Y28F)
Ref Sequence ENSEMBL: ENSMUSP00000091575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092921]
Predicted Effect probably benign
Transcript: ENSMUST00000092921
AA Change: Y28F

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000091575
Gene: ENSMUSG00000095312
AA Change: Y28F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.6e-53 PFAM
Pfam:7TM_GPCR_Srsx 35 305 2.9e-10 PFAM
Pfam:7tm_1 41 290 1.2e-24 PFAM
Meta Mutation Damage Score 0.0799 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414J04Rik A T 11: 21,507,249 noncoding transcript Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Afdn C T 17: 13,846,286 T580I probably benign Het
Ankfy1 G T 11: 72,712,185 L13F probably damaging Het
Arhgap12 T C 18: 6,111,936 T143A probably benign Het
Arsi T G 18: 60,917,352 W436G probably damaging Het
Bcl2l10 C T 9: 75,348,198 T99M probably damaging Het
C77080 A G 4: 129,222,487 S783P possibly damaging Het
Cacna1a A G 8: 84,559,087 Q740R probably damaging Het
Cacna1g A G 11: 94,459,825 F398S probably damaging Het
Ccrl2 A C 9: 111,055,657 Y258D probably damaging Het
Cemip T A 7: 83,999,237 D38V probably damaging Het
Chd6 C G 2: 160,965,483 C1937S possibly damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Col1a2 T G 6: 4,521,387 probably benign Het
Col4a1 T C 8: 11,240,069 probably null Het
Cops7b T A 1: 86,592,334 L69Q probably damaging Het
Crb1 CG C 1: 139,237,086 probably null Het
Ddx3y T A Y: 1,278,949 D163V possibly damaging Het
Dnajc19 A G 3: 34,078,735 probably benign Het
Fam160b2 T C 14: 70,588,709 T288A possibly damaging Het
G2e3 T A 12: 51,364,030 probably benign Het
Gimap7 A G 6: 48,723,501 N7S probably benign Het
Gkap1 G A 13: 58,263,932 probably benign Het
Gm3404 G A 5: 146,526,896 R117Q probably benign Het
Herc1 T TN 9: 66,434,063 probably benign Homo
Homer3 T C 8: 70,286,335 Y115H probably benign Het
Ighv10-1 T A 12: 114,479,069 M99L probably benign Het
Kdm2b A C 5: 122,932,674 S398R probably damaging Het
Lyl1 C T 8: 84,702,671 P3L possibly damaging Het
Mettl25 G A 10: 105,826,027 Q361* probably null Het
Mkrn2 T A 6: 115,613,535 I284N probably damaging Het
Mmp14 T A 14: 54,439,106 N369K probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Myo6 C G 9: 80,292,467 N1019K probably damaging Het
Myo7a C T 7: 98,056,767 V1857I probably damaging Het
Nktr T C 9: 121,746,466 S347P probably damaging Het
Nup210 T G 6: 91,030,190 D548A probably damaging Het
Nup210l A G 3: 90,190,887 Y1382C possibly damaging Het
Olfr295 G A 7: 86,586,012 V246M probably damaging Het
Pax8 T C 2: 24,421,391 probably benign Het
Pcdhgb7 A G 18: 37,751,882 Y35C probably damaging Het
Pld1 A T 3: 28,029,167 R145S probably benign Het
Pom121 G A 5: 135,382,081 P741S unknown Het
Rarb T C 14: 16,436,910 N204D probably damaging Het
Sdc3 A G 4: 130,821,504 E337G probably benign Het
Serpina9 T C 12: 104,001,437 K233R probably null Het
Speer4c A C 5: 15,714,216 probably benign Het
Sspo T A 6: 48,451,065 M159K probably benign Het
Stxbp4 C A 11: 90,607,184 R96S probably damaging Het
Tg A C 15: 66,740,718 E375A probably damaging Het
Tmem176b A G 6: 48,838,353 V2A probably benign Het
Toporsl G A 4: 52,610,281 C58Y probably damaging Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Vav3 T C 3: 109,563,094 probably benign Het
Zfp180 T A 7: 24,104,745 D196E possibly damaging Het
Zfp407 C T 18: 84,209,955 S1843N probably damaging Het
Other mutations in Olfr382
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Olfr382 APN 11 73516410 missense possibly damaging 0.59
IGL00896:Olfr382 APN 11 73516341 missense probably damaging 1.00
IGL01723:Olfr382 APN 11 73516626 missense probably damaging 1.00
IGL01734:Olfr382 APN 11 73516636 missense probably benign 0.39
IGL02267:Olfr382 APN 11 73516549 missense probably benign 0.44
IGL02681:Olfr382 APN 11 73516530 missense probably benign
IGL03165:Olfr382 APN 11 73516884 nonsense probably null
BB009:Olfr382 UTSW 11 73517157 missense probably damaging 1.00
BB019:Olfr382 UTSW 11 73517157 missense probably damaging 1.00
R0320:Olfr382 UTSW 11 73516924 missense probably damaging 1.00
R0633:Olfr382 UTSW 11 73516927 missense probably benign 0.23
R0638:Olfr382 UTSW 11 73516924 missense probably damaging 1.00
R0691:Olfr382 UTSW 11 73516844 missense possibly damaging 0.55
R1630:Olfr382 UTSW 11 73516720 missense probably damaging 1.00
R2269:Olfr382 UTSW 11 73516483 missense probably damaging 1.00
R4001:Olfr382 UTSW 11 73516986 missense probably damaging 1.00
R4925:Olfr382 UTSW 11 73517172 missense possibly damaging 0.87
R5707:Olfr382 UTSW 11 73516625 missense probably damaging 1.00
R5911:Olfr382 UTSW 11 73516525 missense probably damaging 1.00
R6225:Olfr382 UTSW 11 73517005 missense probably damaging 0.99
R6251:Olfr382 UTSW 11 73516708 missense probably benign 0.00
R6332:Olfr382 UTSW 11 73517175 missense probably benign 0.00
R7013:Olfr382 UTSW 11 73516421 nonsense probably null
R7196:Olfr382 UTSW 11 73517131 missense probably benign
R7443:Olfr382 UTSW 11 73516848 missense possibly damaging 0.89
R7932:Olfr382 UTSW 11 73517157 missense probably damaging 1.00
R8201:Olfr382 UTSW 11 73517073 missense probably damaging 1.00
R8257:Olfr382 UTSW 11 73516377 missense probably benign 0.28
R8547:Olfr382 UTSW 11 73516614 missense probably damaging 1.00
Z1177:Olfr382 UTSW 11 73517035 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCAGACAGCCAGCATAGGAG -3'
(R):5'- TGACTGCAAAATCCACTGTGGTAG -3'

Sequencing Primer
(F):5'- ACGTGTCCTGGCTCTGCATG -3'
(R):5'- CTTGAATTTTAAGGGACATGGA -3'
Posted On2017-01-30