Mutagenetix > Incidental Mutation

Incidental Mutation 'IGL03134:Zfp407'

453193

Institutional Source

Beutler Lab

Gene Symbol

Zfp407

Ensembl Gene

ENSMUSG00000048410

Gene Name

zinc finger protein 407

Synonyms

6430585N13Rik, LOC240469, LOC381139

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

IGL03134 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

84128027-84589725 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 84209955 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Asparagine at position 1843 (S1843N)

Ref Sequence

ENSEMBL: ENSMUSP00000118361 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000125763]

AlphaFold

G3UVV3

Predicted Effect

probably benign
Transcript: ENSMUST00000125450

Predicted Effect

probably damaging
Transcript: ENSMUST00000125763
AA Change: S1843N

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000118361
Gene: ENSMUSG00000048410
AA Change: S1843N

Domain	Start	End	E-Value	Type
low complexity region	20	37	N/A	INTRINSIC
ZnF_C2H2	178	200	8.67e-1	SMART
ZnF_U1	233	267	6.79e-1	SMART
ZnF_C2H2	236	260	4.65e-1	SMART
ZnF_C2H2	522	545	7.05e-1	SMART
ZnF_U1	548	582	1.54e1	SMART
ZnF_C2H2	551	575	1.01e-1	SMART
ZnF_C2H2	582	605	1.41e0	SMART
ZnF_U1	606	639	2.22e0	SMART
ZnF_C2H2	609	632	1.01e2	SMART
ZnF_C2H2	695	718	6.23e-2	SMART
ZnF_U1	721	755	2.96e0	SMART
ZnF_C2H2	724	748	7.11e0	SMART
ZnF_C2H2	840	863	7.55e-1	SMART
ZnF_U1	866	900	3.81e-1	SMART
ZnF_C2H2	869	893	1.07e0	SMART
ZnF_C2H2	1009	1032	6.13e-1	SMART
ZnF_U1	1035	1069	2.22e0	SMART
ZnF_C2H2	1038	1062	5.62e0	SMART
low complexity region	1223	1234	N/A	INTRINSIC
ZnF_C2H2	1405	1428	5.92e0	SMART
ZnF_U1	1432	1466	2.35e0	SMART
ZnF_C2H2	1435	1459	1.76e-1	SMART
ZnF_C2H2	1477	1500	5.42e-2	SMART
ZnF_C2H2	1528	1552	1.68e1	SMART
ZnF_C2H2	1558	1580	1.43e-1	SMART
ZnF_C2H2	1586	1609	9.58e-3	SMART
ZnF_C2H2	1619	1641	2.61e-4	SMART
ZnF_C2H2	1647	1671	1.04e-3	SMART
ZnF_C2H2	1677	1699	9.44e-2	SMART
ZnF_C2H2	1705	1727	1.82e-3	SMART
ZnF_C2H2	1733	1758	4.65e-1	SMART
ZnF_C2H2	1764	1787	1.26e-2	SMART
low complexity region	1876	1887	N/A	INTRINSIC
low complexity region	2017	2032	N/A	INTRINSIC

Meta Mutation Damage Score

0.0879

Coding Region Coverage

1x: 0.0%
3x: 0.0%
10x: 0.0%
20x: 0.0%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein whose exact function is not known. It may be involved in transcriptional regulation. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414J04Rik	A	T	11: 21,507,249		noncoding transcript	Het
4933416I08Rik	TCC	TCCC	X: 53,690,895		noncoding transcript	Het
Afdn	C	T	17: 13,846,286	T580I	probably benign	Het
Ankfy1	G	T	11: 72,712,185	L13F	probably damaging	Het
Arhgap12	T	C	18: 6,111,936	T143A	probably benign	Het
Arsi	T	G	18: 60,917,352	W436G	probably damaging	Het
Bcl2l10	C	T	9: 75,348,198	T99M	probably damaging	Het
C77080	A	G	4: 129,222,487	S783P	possibly damaging	Het
Cacna1a	A	G	8: 84,559,087	Q740R	probably damaging	Het
Cacna1g	A	G	11: 94,459,825	F398S	probably damaging	Het
Ccrl2	A	C	9: 111,055,657	Y258D	probably damaging	Het
Cemip	T	A	7: 83,999,237	D38V	probably damaging	Het
Chd6	C	G	2: 160,965,483	C1937S	possibly damaging	Het
Cilp	TGGG	TGG	9: 65,280,130		probably null	Het
Col1a2	T	G	6: 4,521,387		probably benign	Het
Col4a1	T	C	8: 11,240,069		probably null	Het
Cops7b	T	A	1: 86,592,334	L69Q	probably damaging	Het
Crb1	CG	C	1: 139,237,086		probably null	Het
Ddx3y	T	A	Y: 1,278,949	D163V	possibly damaging	Het
Dnajc19	A	G	3: 34,078,735		probably benign	Het
Fam160b2	T	C	14: 70,588,709	T288A	possibly damaging	Het
G2e3	T	A	12: 51,364,030		probably benign	Het
Gimap7	A	G	6: 48,723,501	N7S	probably benign	Het
Gkap1	G	A	13: 58,263,932		probably benign	Het
Gm3404	G	A	5: 146,526,896	R117Q	probably benign	Het
Herc1	T	TN	9: 66,434,063		probably benign	Homo
Homer3	T	C	8: 70,286,335	Y115H	probably benign	Het
Ighv10-1	T	A	12: 114,479,069	M99L	probably benign	Het
Kdm2b	A	C	5: 122,932,674	S398R	probably damaging	Het
Lyl1	C	T	8: 84,702,671	P3L	possibly damaging	Het
Mettl25	G	A	10: 105,826,027	Q361*	probably null	Het
Mkrn2	T	A	6: 115,613,535	I284N	probably damaging	Het
Mmp14	T	A	14: 54,439,106	N369K	probably damaging	Het
Mmp1a	TG	TGG	9: 7,465,083		probably null	Het
Myo6	C	G	9: 80,292,467	N1019K	probably damaging	Het
Myo7a	C	T	7: 98,056,767	V1857I	probably damaging	Het
Nktr	T	C	9: 121,746,466	S347P	probably damaging	Het
Nup210	T	G	6: 91,030,190	D548A	probably damaging	Het
Nup210l	A	G	3: 90,190,887	Y1382C	possibly damaging	Het
Olfr295	G	A	7: 86,586,012	V246M	probably damaging	Het
Olfr382	T	A	11: 73,517,115	Y28F	probably benign	Het
Pax8	T	C	2: 24,421,391		probably benign	Het
Pcdhgb7	A	G	18: 37,751,882	Y35C	probably damaging	Het
Pld1	A	T	3: 28,029,167	R145S	probably benign	Het
Pom121	G	A	5: 135,382,081	P741S	unknown	Het
Rarb	T	C	14: 16,436,910	N204D	probably damaging	Het
Sdc3	A	G	4: 130,821,504	E337G	probably benign	Het
Serpina9	T	C	12: 104,001,437	K233R	probably null	Het
Speer4c	A	C	5: 15,714,216		probably benign	Het
Sspo	T	A	6: 48,451,065	M159K	probably benign	Het
Stxbp4	C	A	11: 90,607,184	R96S	probably damaging	Het
Tg	A	C	15: 66,740,718	E375A	probably damaging	Het
Tmem176b	A	G	6: 48,838,353	V2A	probably benign	Het
Toporsl	G	A	4: 52,610,281	C58Y	probably damaging	Het
Ugt1a1	AT	A	1: 88,212,371		probably null	Het
Vav3	T	C	3: 109,563,094		probably benign	Het
Zfp180	T	A	7: 24,104,745	D196E	possibly damaging	Het

Other mutations in Zfp407

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00499:Zfp407	APN	18	84561752	missense	probably damaging	0.99
IGL02105:Zfp407	APN	18	84562720	nonsense	probably null
IGL02110:Zfp407	APN	18	84559040	missense	probably benign	0.00
IGL02343:Zfp407	APN	18	84209724	missense	possibly damaging	0.71
IGL02456:Zfp407	APN	18	84558641	missense	probably damaging	1.00
IGL02705:Zfp407	APN	18	84559031	nonsense	probably null
IGL02946:Zfp407	APN	18	84560709	missense	probably damaging	1.00
IGL03069:Zfp407	APN	18	84350975	missense	probably damaging	1.00
IGL03145:Zfp407	APN	18	84209721	missense	probably damaging	0.99
IGL03403:Zfp407	APN	18	84560797	missense	probably damaging	1.00
PIT4362001:Zfp407	UTSW	18	84561268	missense	possibly damaging	0.87
PIT4520001:Zfp407	UTSW	18	84432420	missense	probably damaging	0.99
R0087:Zfp407	UTSW	18	84560411	missense	probably damaging	1.00
R0243:Zfp407	UTSW	18	84558711	missense	probably damaging	1.00
R0594:Zfp407	UTSW	18	84562567	missense	possibly damaging	0.87
R0766:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R0787:Zfp407	UTSW	18	84209022	missense	probably damaging	1.00
R0787:Zfp407	UTSW	18	84209346	missense	probably benign	0.00
R1065:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1086:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1165:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1186:Zfp407	UTSW	18	84209448	missense	probably benign	0.39
R1203:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1312:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1345:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1385:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1421:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1430:Zfp407	UTSW	18	84209455	missense	probably benign	0.18
R1436:Zfp407	UTSW	18	84343071	splice site	probably benign
R1498:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1526:Zfp407	UTSW	18	84561033	missense	possibly damaging	0.61
R1579:Zfp407	UTSW	18	84209638	missense	probably benign	0.00
R1594:Zfp407	UTSW	18	84209331	missense	probably benign	0.01
R1628:Zfp407	UTSW	18	84354533	missense	probably damaging	1.00
R1698:Zfp407	UTSW	18	84562157	missense	probably damaging	1.00
R1962:Zfp407	UTSW	18	84559336	missense	probably benign	0.01
R1984:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1985:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1986:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R2151:Zfp407	UTSW	18	84209649	missense	possibly damaging	0.55
R2152:Zfp407	UTSW	18	84209649	missense	possibly damaging	0.55
R2154:Zfp407	UTSW	18	84209649	missense	possibly damaging	0.55
R2259:Zfp407	UTSW	18	84209793	missense	probably damaging	1.00
R2353:Zfp407	UTSW	18	84559880	missense	probably damaging	1.00
R2845:Zfp407	UTSW	18	84558397	nonsense	probably null
R3407:Zfp407	UTSW	18	84558872	missense	probably benign	0.08
R3432:Zfp407	UTSW	18	84208746	missense	probably damaging	1.00
R3892:Zfp407	UTSW	18	84560352	missense	probably damaging	1.00
R4026:Zfp407	UTSW	18	84559596	missense	possibly damaging	0.82
R4107:Zfp407	UTSW	18	84343007	missense	possibly damaging	0.82
R4398:Zfp407	UTSW	18	84562731	nonsense	probably null
R4447:Zfp407	UTSW	18	84562694	missense	possibly damaging	0.95
R4752:Zfp407	UTSW	18	84562914	missense	probably benign	0.01
R4881:Zfp407	UTSW	18	84559703	missense	probably benign	0.27
R4936:Zfp407	UTSW	18	84559464	missense	probably benign	0.00
R5194:Zfp407	UTSW	18	84561309	missense	probably benign	0.05
R5243:Zfp407	UTSW	18	84561091	missense	probably damaging	1.00
R5258:Zfp407	UTSW	18	84315926	missense	probably damaging	1.00
R5591:Zfp407	UTSW	18	84561137	missense	probably damaging	1.00
R5633:Zfp407	UTSW	18	84561044	missense	probably benign	0.35
R5739:Zfp407	UTSW	18	84208742	makesense	probably null
R5806:Zfp407	UTSW	18	84558614	missense	probably damaging	1.00
R5820:Zfp407	UTSW	18	84560524	missense	probably benign	0.01
R6187:Zfp407	UTSW	18	84559009	missense	possibly damaging	0.87
R6512:Zfp407	UTSW	18	84560349	missense	probably damaging	1.00
R6521:Zfp407	UTSW	18	84432411	missense	probably damaging	1.00
R6748:Zfp407	UTSW	18	84208830	missense	probably damaging	0.98
R6882:Zfp407	UTSW	18	84343069	splice site	probably null
R6899:Zfp407	UTSW	18	84561434	missense	possibly damaging	0.86
R7038:Zfp407	UTSW	18	84561857	missense	probably damaging	1.00
R7076:Zfp407	UTSW	18	84558476	missense	probably damaging	1.00
R7326:Zfp407	UTSW	18	84559042	missense	possibly damaging	0.77
R7397:Zfp407	UTSW	18	84561819	missense	possibly damaging	0.59
R7402:Zfp407	UTSW	18	84561536	missense	probably benign	0.02
R7783:Zfp407	UTSW	18	84209922	missense	possibly damaging	0.69
R7800:Zfp407	UTSW	18	84560675	missense	probably damaging	0.99
R7904:Zfp407	UTSW	18	84561256	missense	not run
R7942:Zfp407	UTSW	18	84559629	missense	probably benign	0.02
R7955:Zfp407	UTSW	18	84559291	missense	probably benign	0.02
R7988:Zfp407	UTSW	18	84559400	missense	possibly damaging	0.60
R8125:Zfp407	UTSW	18	84561185	missense	probably damaging	1.00
R8237:Zfp407	UTSW	18	84560144	missense	possibly damaging	0.87
R8364:Zfp407	UTSW	18	84552868	critical splice donor site	probably null
R8443:Zfp407	UTSW	18	84209862	missense	probably damaging	1.00
R8487:Zfp407	UTSW	18	84562770	nonsense	probably null
R8497:Zfp407	UTSW	18	84559896	missense	probably damaging	0.98
R8808:Zfp407	UTSW	18	84343060	missense	probably benign	0.17
R8848:Zfp407	UTSW	18	84560694	missense	probably damaging	1.00
R8913:Zfp407	UTSW	18	84560528	missense	probably damaging	0.99
R8962:Zfp407	UTSW	18	84558932	missense	probably damaging	1.00
R9087:Zfp407	UTSW	18	84209857	missense	probably damaging	0.96
R9452:Zfp407	UTSW	18	84562454	missense	probably benign	0.02
R9691:Zfp407	UTSW	18	84560187	missense	probably benign	0.03
R9766:Zfp407	UTSW	18	84559449	missense	probably benign	0.06
RF003:Zfp407	UTSW	18	84209563	missense	probably benign	0.17
Z1177:Zfp407	UTSW	18	84209954	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- ATGCGACCCGTTCTGACTTG -3'
(R):5'- CAGAAAGCTGTCTAAGTTGACTC -3'

Sequencing Primer
(F):5'- ACTTGTGGCAATGACCTGC -3'
(R):5'- AGCTGTCTAAGTTGACTCTTGAAG -3'

Posted On

2017-01-30