Incidental Mutation 'IGL03097:Gstm3'
ID453205
Institutional Source Beutler Lab
Gene Symbol Gstm3
Ensembl Gene ENSMUSG00000004038
Gene Nameglutathione S-transferase, mu 3
SynonymsmGSTM5, Fsc2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #IGL03097 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location107963696-107969283 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107968801 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 25 (D25G)
Ref Sequence ENSEMBL: ENSMUSP00000004136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004136]
Predicted Effect probably benign
Transcript: ENSMUST00000004136
AA Change: D25G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000004136
Gene: ENSMUSG00000004038
AA Change: D25G

DomainStartEndE-ValueType
Pfam:GST_N 3 82 6.6e-22 PFAM
Pfam:GST_C_3 41 190 7.7e-11 PFAM
Pfam:GST_C 104 191 1.6e-17 PFAM
Meta Mutation Damage Score 0.0756 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 90% (46/51)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Adcy9 T C 16: 4,418,066 T257A possibly damaging Het
Ahnak A G 19: 9,002,387 D345G probably benign Het
Ak5 A G 3: 152,660,514 probably null Het
Akap3 A G 6: 126,866,416 K666R probably damaging Het
Alpk3 A G 7: 81,093,909 N1158S probably benign Het
Atp23 A T 10: 126,887,687 V182E probably damaging Het
Atp4a A G 7: 30,723,037 D898G probably benign Het
Bnip3 T C 7: 138,894,479 N140S probably damaging Het
Bptf T C 11: 107,077,680 Y1059C probably damaging Het
Cacna1h A T 17: 25,391,144 I796N probably damaging Het
Ccnb2 A G 9: 70,409,396 probably benign Het
Cd3g T A 9: 44,970,763 D165V probably damaging Het
Cfap70 T C 14: 20,448,608 T4A probably benign Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Cntn4 C T 6: 106,353,712 T97M probably benign Het
Crb1 CG C 1: 139,237,086 probably null Het
Crim1 C T 17: 78,367,798 T812I probably benign Het
Csmd1 G T 8: 15,945,127 T2636K probably damaging Het
Cyp39a1 T A 17: 43,683,050 Y200* probably null Het
Dlg4 T G 11: 70,042,202 I478S probably damaging Het
Dsc3 A T 18: 19,974,048 N505K probably benign Het
Efhc1 T C 1: 20,972,825 W323R probably damaging Het
Ehhadh T A 16: 21,762,770 I491L probably benign Het
Ggt6 T G 11: 72,436,813 H148Q possibly damaging Het
Gtf2h3 G A 5: 124,602,168 probably benign Het
Hjurp TGGG TTGCGGG 1: 88,266,280 probably benign Het
Hnf4g A C 3: 3,651,614 E281A probably damaging Het
Impg1 T G 9: 80,379,952 E404A possibly damaging Het
Kcna2 T C 3: 107,105,399 V432A probably benign Het
Map3k2 T G 18: 32,200,017 D81E probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mmp9 T A 2: 164,950,806 probably null Het
Mroh2a G A 1: 88,235,376 R376H probably benign Het
Ms4a1 G T 19: 11,253,192 T215N probably benign Het
Pam16 T C 16: 4,616,594 I111V probably benign Het
Pde6c A G 19: 38,178,271 T720A probably damaging Het
Pgap2 T C 7: 102,236,227 L100P probably damaging Het
Ppl T A 16: 5,096,726 S686C probably damaging Het
Rnls A G 19: 33,138,279 probably benign Het
Robo3 A C 9: 37,422,528 probably null Het
Rptn G A 3: 93,397,373 G671D probably damaging Het
Slc6a21 C T 7: 45,288,168 Q628* probably null Het
Smg6 T G 11: 74,932,426 I708S probably damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Thap1 C G 8: 26,162,470 P79A probably benign Het
Vmn1r202 G A 13: 22,501,470 T259I probably benign Het
Other mutations in Gstm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01585:Gstm3 APN 3 107966158 missense probably benign 0.42
IGL01637:Gstm3 APN 3 107967633 missense probably damaging 1.00
IGL01937:Gstm3 APN 3 107967657 missense probably damaging 0.98
IGL01945:Gstm3 APN 3 107967657 missense probably damaging 0.98
IGL02307:Gstm3 APN 3 107967613 missense probably damaging 0.98
IGL02820:Gstm3 APN 3 107968758 splice site probably benign
IGL03038:Gstm3 APN 3 107966169 missense possibly damaging 0.75
IGL03108:Gstm3 APN 3 107967764 critical splice donor site probably null
IGL03271:Gstm3 APN 3 107966197 missense possibly damaging 0.47
R0009:Gstm3 UTSW 3 107967840 missense probably damaging 1.00
R0883:Gstm3 UTSW 3 107966270 splice site probably benign
R1623:Gstm3 UTSW 3 107967835 missense possibly damaging 0.80
R2108:Gstm3 UTSW 3 107966134 missense probably damaging 0.99
R3005:Gstm3 UTSW 3 107967607 missense probably benign 0.03
R3802:Gstm3 UTSW 3 107964235 missense probably benign 0.03
R3803:Gstm3 UTSW 3 107964235 missense probably benign 0.03
R3804:Gstm3 UTSW 3 107964235 missense probably benign 0.03
R4604:Gstm3 UTSW 3 107968197 missense possibly damaging 0.73
R4837:Gstm3 UTSW 3 107964215 missense probably benign
R6593:Gstm3 UTSW 3 107968195 missense probably benign 0.01
R6963:Gstm3 UTSW 3 107967624 missense probably benign 0.01
R7790:Gstm3 UTSW 3 107969239 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CCTCAAGAGGTTCCTGGAAG -3'
(R):5'- TTTTCTTAGCACCCTGGAGC -3'

Sequencing Primer
(F):5'- TCCTGGAAGGAGCAGGCTC -3'
(R):5'- TCACAAACTTGGGAGGCTGC -3'
Posted On2017-01-31