Incidental Mutation 'IGL03097:Atp4a'
ID 453212
Institutional Source Beutler Lab
Gene Symbol Atp4a
Ensembl Gene ENSMUSG00000005553
Gene Name ATPase, H+/K+ exchanging, gastric, alpha polypeptide
Synonyms H+K+-transporting alpha 1, H+/K+-ATPase alpha
Accession Numbers
Essential gene? Probably non essential (E-score: 0.085) question?
Stock # IGL03097 (G1)
Quality Score 215
Status Validated
Chromosome 7
Chromosomal Location 30411634-30424959 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 30422462 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 898 (D898G)
Ref Sequence ENSEMBL: ENSMUSP00000131964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005692] [ENSMUST00000006478] [ENSMUST00000170371] [ENSMUST00000171014] [ENSMUST00000208169] [ENSMUST00000207779] [ENSMUST00000207263] [ENSMUST00000207296] [ENSMUST00000209065]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000005692
AA Change: D907G

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000005692
Gene: ENSMUSG00000005553
AA Change: D907G

DomainStartEndE-ValueType
Pfam:H-K_ATPase_N 2 42 5.4e-23 PFAM
Cation_ATPase_N 52 126 2.26e-18 SMART
Pfam:E1-E2_ATPase 144 375 1.1e-57 PFAM
Pfam:Hydrolase 380 739 5.3e-16 PFAM
Pfam:HAD 383 736 1.9e-18 PFAM
Pfam:Cation_ATPase 436 531 1.6e-24 PFAM
Pfam:Cation_ATPase_C 809 1019 4.8e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000006478
SMART Domains Protein: ENSMUSP00000006478
Gene: ENSMUSG00000006315

DomainStartEndE-ValueType
Pfam:DUF2053 2 158 3.1e-69 PFAM
transmembrane domain 168 190 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167761
Predicted Effect probably benign
Transcript: ENSMUST00000170371
AA Change: D898G

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000131964
Gene: ENSMUSG00000005553
AA Change: D898G

DomainStartEndE-ValueType
Pfam:H-K_ATPase_N 2 42 4.9e-28 PFAM
Cation_ATPase_N 52 126 2.26e-18 SMART
Pfam:E1-E2_ATPase 145 376 1e-62 PFAM
Pfam:Hydrolase 380 730 9.3e-25 PFAM
Pfam:HAD 383 727 2.1e-15 PFAM
Pfam:Hydrolase_like2 436 531 4e-25 PFAM
Pfam:Cation_ATPase_C 800 1010 1.5e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171014
Predicted Effect probably benign
Transcript: ENSMUST00000208169
Predicted Effect probably benign
Transcript: ENSMUST00000207779
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207955
Predicted Effect probably benign
Transcript: ENSMUST00000207263
Predicted Effect probably benign
Transcript: ENSMUST00000207296
Predicted Effect probably benign
Transcript: ENSMUST00000209065
Meta Mutation Damage Score 0.4620 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 90% (46/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of P-type cation-transporting ATPases. The gastric H+, K+-ATPase is a heterodimer consisting of a high molecular weight catalytic alpha subunit and a smaller but heavily glycosylated beta subunit. This enzyme is a proton pump that catalyzes the hydrolysis of ATP coupled with the exchange of H(+) and K(+) ions across the plasma membrane. It is also responsible for gastric acid secretion. This gene encodes a catalytic alpha subunit of the gastric H+, K+-ATPase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in achlorhydria, hypergastrinemia, and abnormalities of the parietal cells. Mice homozygous for an ENU-induced allele exhibit iron-deficiency anemia. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416I08Rik TCC TCCC X: 52,692,862 (GRCm39) noncoding transcript Het
Adcy9 T C 16: 4,235,930 (GRCm39) T257A possibly damaging Het
Ahnak A G 19: 8,979,751 (GRCm39) D345G probably benign Het
Ak5 A G 3: 152,366,151 (GRCm39) probably null Het
Akap3 A G 6: 126,843,379 (GRCm39) K666R probably damaging Het
Alpk3 A G 7: 80,743,657 (GRCm39) N1158S probably benign Het
Atp23 A T 10: 126,723,556 (GRCm39) V182E probably damaging Het
Bnip3 T C 7: 138,496,208 (GRCm39) N140S probably damaging Het
Bptf T C 11: 106,968,506 (GRCm39) Y1059C probably damaging Het
Cacna1h A T 17: 25,610,118 (GRCm39) I796N probably damaging Het
Ccnb2 A G 9: 70,316,678 (GRCm39) probably benign Het
Cd3g T A 9: 44,882,061 (GRCm39) D165V probably damaging Het
Cfap70 T C 14: 20,498,676 (GRCm39) T4A probably benign Het
Cilp TGGG TGG 9: 65,187,412 (GRCm39) probably null Het
Cntn4 C T 6: 106,330,673 (GRCm39) T97M probably benign Het
Crb1 CG C 1: 139,164,824 (GRCm39) probably null Het
Crim1 C T 17: 78,675,227 (GRCm39) T812I probably benign Het
Csmd1 G T 8: 15,995,127 (GRCm39) T2636K probably damaging Het
Cyp39a1 T A 17: 43,993,941 (GRCm39) Y200* probably null Het
Dlg4 T G 11: 69,933,028 (GRCm39) I478S probably damaging Het
Dsc3 A T 18: 20,107,105 (GRCm39) N505K probably benign Het
Efhc1 T C 1: 21,043,049 (GRCm39) W323R probably damaging Het
Ehhadh T A 16: 21,581,520 (GRCm39) I491L probably benign Het
Ggt6 T G 11: 72,327,639 (GRCm39) H148Q possibly damaging Het
Gstm3 T C 3: 107,876,117 (GRCm39) D25G probably benign Het
Gtf2h3 G A 5: 124,740,231 (GRCm39) probably benign Het
Hjurp TGGG TTGCGGG 1: 88,194,002 (GRCm39) probably benign Het
Hnf4g A C 3: 3,716,674 (GRCm39) E281A probably damaging Het
Impg1 T G 9: 80,287,234 (GRCm39) E404A possibly damaging Het
Kcna2 T C 3: 107,012,715 (GRCm39) V432A probably benign Het
Map3k2 T G 18: 32,333,070 (GRCm39) D81E probably benign Het
Mmp1a TG TGG 9: 7,465,083 (GRCm38) probably null Het
Mmp9 T A 2: 164,792,726 (GRCm39) probably null Het
Mroh2a G A 1: 88,163,098 (GRCm39) R376H probably benign Het
Ms4a1 G T 19: 11,230,556 (GRCm39) T215N probably benign Het
Pam16 T C 16: 4,434,458 (GRCm39) I111V probably benign Het
Pde6c A G 19: 38,166,719 (GRCm39) T720A probably damaging Het
Pgap2 T C 7: 101,885,434 (GRCm39) L100P probably damaging Het
Ppl T A 16: 4,914,590 (GRCm39) S686C probably damaging Het
Rnls A G 19: 33,115,679 (GRCm39) probably benign Het
Robo3 A C 9: 37,333,824 (GRCm39) probably null Het
Rptn G A 3: 93,304,680 (GRCm39) G671D probably damaging Het
Slc6a21 C T 7: 44,937,592 (GRCm39) Q628* probably null Het
Smg6 T G 11: 74,823,252 (GRCm39) I708S probably damaging Het
Speer4c1 A C 5: 15,919,214 (GRCm39) probably benign Het
Thap1 C G 8: 26,652,498 (GRCm39) P79A probably benign Het
Vmn1r202 G A 13: 22,685,640 (GRCm39) T259I probably benign Het
Other mutations in Atp4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Atp4a APN 7 30,412,629 (GRCm39) missense possibly damaging 0.95
IGL01327:Atp4a APN 7 30,412,675 (GRCm39) missense possibly damaging 0.96
IGL01510:Atp4a APN 7 30,420,216 (GRCm39) missense probably benign 0.02
IGL01763:Atp4a APN 7 30,414,943 (GRCm39) missense probably benign 0.20
IGL02061:Atp4a APN 7 30,414,454 (GRCm39) missense probably damaging 1.00
IGL02435:Atp4a APN 7 30,416,482 (GRCm39) missense probably benign
IGL02903:Atp4a APN 7 30,415,344 (GRCm39) missense probably benign 0.00
IGL03181:Atp4a APN 7 30,424,129 (GRCm39) missense probably benign 0.02
IGL03350:Atp4a APN 7 30,420,292 (GRCm39) missense probably damaging 1.00
atypical UTSW 7 30,414,781 (GRCm39) missense possibly damaging 0.84
sublytic UTSW 7 30,415,225 (GRCm39) missense probably benign 0.32
R0095:Atp4a UTSW 7 30,420,160 (GRCm39) missense probably damaging 0.99
R0121:Atp4a UTSW 7 30,419,526 (GRCm39) missense probably benign 0.00
R0140:Atp4a UTSW 7 30,419,526 (GRCm39) missense probably benign 0.00
R0241:Atp4a UTSW 7 30,416,560 (GRCm39) missense probably benign 0.00
R0437:Atp4a UTSW 7 30,419,526 (GRCm39) missense probably benign 0.00
R0624:Atp4a UTSW 7 30,418,424 (GRCm39) missense probably benign
R1164:Atp4a UTSW 7 30,417,117 (GRCm39) missense probably benign 0.00
R2105:Atp4a UTSW 7 30,419,793 (GRCm39) critical splice donor site probably null
R2272:Atp4a UTSW 7 30,414,925 (GRCm39) nonsense probably null
R2327:Atp4a UTSW 7 30,419,666 (GRCm39) missense probably benign 0.16
R2881:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R2990:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R2992:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R2993:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R3123:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R3125:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R3441:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R3442:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R3686:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R3687:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R3845:Atp4a UTSW 7 30,416,540 (GRCm39) missense probably null 0.99
R4027:Atp4a UTSW 7 30,424,377 (GRCm39) splice site probably null
R4072:Atp4a UTSW 7 30,414,757 (GRCm39) missense probably benign 0.09
R4433:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R4454:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R4457:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R4458:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R4510:Atp4a UTSW 7 30,423,678 (GRCm39) nonsense probably null
R4511:Atp4a UTSW 7 30,423,678 (GRCm39) nonsense probably null
R4576:Atp4a UTSW 7 30,417,147 (GRCm39) missense probably benign 0.25
R4656:Atp4a UTSW 7 30,419,373 (GRCm39) intron probably benign
R4661:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R4662:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R4852:Atp4a UTSW 7 30,423,693 (GRCm39) missense probably benign 0.10
R4892:Atp4a UTSW 7 30,411,899 (GRCm39) missense probably benign 0.07
R4907:Atp4a UTSW 7 30,418,517 (GRCm39) missense possibly damaging 0.66
R5024:Atp4a UTSW 7 30,415,289 (GRCm39) missense possibly damaging 0.82
R5254:Atp4a UTSW 7 30,414,955 (GRCm39) missense probably damaging 1.00
R5318:Atp4a UTSW 7 30,414,754 (GRCm39) missense probably damaging 1.00
R5340:Atp4a UTSW 7 30,420,231 (GRCm39) missense probably benign
R5484:Atp4a UTSW 7 30,420,097 (GRCm39) unclassified probably benign
R5729:Atp4a UTSW 7 30,411,851 (GRCm39) missense possibly damaging 0.48
R5762:Atp4a UTSW 7 30,418,521 (GRCm39) missense probably damaging 0.99
R5797:Atp4a UTSW 7 30,412,074 (GRCm39) missense probably damaging 1.00
R6030:Atp4a UTSW 7 30,421,941 (GRCm39) missense probably damaging 0.99
R6030:Atp4a UTSW 7 30,421,941 (GRCm39) missense probably damaging 0.99
R6077:Atp4a UTSW 7 30,415,344 (GRCm39) missense probably benign 0.00
R6243:Atp4a UTSW 7 30,415,382 (GRCm39) missense possibly damaging 0.68
R6346:Atp4a UTSW 7 30,414,781 (GRCm39) missense possibly damaging 0.84
R6459:Atp4a UTSW 7 30,411,887 (GRCm39) missense probably benign 0.00
R6515:Atp4a UTSW 7 30,411,903 (GRCm39) missense possibly damaging 0.78
R6773:Atp4a UTSW 7 30,414,802 (GRCm39) missense probably damaging 0.98
R6854:Atp4a UTSW 7 30,414,433 (GRCm39) missense probably benign 0.29
R7215:Atp4a UTSW 7 30,416,785 (GRCm39) missense possibly damaging 0.61
R7271:Atp4a UTSW 7 30,421,944 (GRCm39) missense probably benign 0.16
R7340:Atp4a UTSW 7 30,416,155 (GRCm39) missense possibly damaging 0.94
R7457:Atp4a UTSW 7 30,420,192 (GRCm39) missense probably benign 0.08
R7593:Atp4a UTSW 7 30,424,105 (GRCm39) missense probably benign 0.08
R7712:Atp4a UTSW 7 30,414,978 (GRCm39) missense probably damaging 0.96
R7762:Atp4a UTSW 7 30,419,461 (GRCm39) missense probably damaging 0.96
R8714:Atp4a UTSW 7 30,420,013 (GRCm39) missense probably damaging 0.99
R9324:Atp4a UTSW 7 30,415,207 (GRCm39) missense probably benign 0.02
Z1177:Atp4a UTSW 7 30,417,265 (GRCm39) missense possibly damaging 0.47
Z1186:Atp4a UTSW 7 30,416,782 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GCATGCACTTTGTCTGTGTC -3'
(R):5'- GAGTCACCTCTATCTGAAAGCCTC -3'

Sequencing Primer
(F):5'- CCCTGTGCTCTGTGTGTGC -3'
(R):5'- CCTCAGAAGCAGAAGATGAAGC -3'
Posted On 2017-01-31