Incidental Mutation 'IGL03097:Csmd1'
ID 453217
Institutional Source Beutler Lab
Gene Symbol Csmd1
Ensembl Gene ENSMUSG00000060924
Gene Name CUB and Sushi multiple domains 1
Synonyms
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # IGL03097 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 15942537-17585602 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 15995127 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 2636 (T2636K)
Ref Sequence ENSEMBL: ENSMUSP00000080751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082104]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000082104
AA Change: T2636K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080751
Gene: ENSMUSG00000060924
AA Change: T2636K

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
CUB 32 140 1.46e-26 SMART
CCP 145 202 1.01e-11 SMART
CUB 208 312 1.05e-27 SMART
CCP 349 406 1.28e-8 SMART
CUB 411 522 2.34e-25 SMART
CCP 527 580 1.22e-14 SMART
CUB 584 692 1.61e-37 SMART
CCP 697 754 4.41e-12 SMART
CUB 758 866 6.55e-38 SMART
CCP 873 926 2.53e-12 SMART
CUB 930 1040 8.94e-22 SMART
CCP 1045 1100 7.06e-11 SMART
CUB 1104 1212 3.14e-26 SMART
CCP 1217 1273 1.18e-12 SMART
CUB 1277 1386 9.72e-32 SMART
CCP 1391 1447 2.06e-12 SMART
CUB 1451 1559 1.68e-35 SMART
CCP 1564 1621 2.53e-12 SMART
CUB 1625 1733 4.24e-14 SMART
CCP 1741 1798 9.46e-12 SMART
CUB 1802 1910 4.23e-32 SMART
CCP 1915 1970 8.23e-12 SMART
CUB 1974 2082 8.59e-33 SMART
CCP 2087 2142 6.09e-15 SMART
CUB 2146 2253 2.36e-30 SMART
CCP 2258 2315 1.1e-12 SMART
CUB 2320 2430 4.3e-24 SMART
CCP 2432 2490 2.94e-8 SMART
CCP 2495 2552 2.03e-11 SMART
CCP 2557 2617 1.22e-5 SMART
CCP 2622 2675 2.72e-12 SMART
CCP 2680 2733 5.86e-17 SMART
CCP 2738 2791 6.09e-15 SMART
CCP 2796 2854 9.1e-14 SMART
CCP 2859 2912 3.96e-14 SMART
CCP 2920 2973 4.41e-12 SMART
CCP 2978 3032 2.94e-8 SMART
CCP 3037 3092 6.59e-11 SMART
CCP 3097 3150 4.12e-12 SMART
CCP 3155 3208 7.92e-14 SMART
CCP 3216 3270 2.8e-14 SMART
CCP 3275 3330 3.78e-11 SMART
transmembrane domain 3487 3509 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125551
Meta Mutation Damage Score 0.3406 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 90% (46/51)
MGI Phenotype PHENOTYPE: Mice exhibit normal pre-pulse inhibition, social interaction, sucrose preference and d-amphetamine sensitivity. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416I08Rik TCC TCCC X: 52,692,862 (GRCm39) noncoding transcript Het
Adcy9 T C 16: 4,235,930 (GRCm39) T257A possibly damaging Het
Ahnak A G 19: 8,979,751 (GRCm39) D345G probably benign Het
Ak5 A G 3: 152,366,151 (GRCm39) probably null Het
Akap3 A G 6: 126,843,379 (GRCm39) K666R probably damaging Het
Alpk3 A G 7: 80,743,657 (GRCm39) N1158S probably benign Het
Atp23 A T 10: 126,723,556 (GRCm39) V182E probably damaging Het
Atp4a A G 7: 30,422,462 (GRCm39) D898G probably benign Het
Bnip3 T C 7: 138,496,208 (GRCm39) N140S probably damaging Het
Bptf T C 11: 106,968,506 (GRCm39) Y1059C probably damaging Het
Cacna1h A T 17: 25,610,118 (GRCm39) I796N probably damaging Het
Ccnb2 A G 9: 70,316,678 (GRCm39) probably benign Het
Cd3g T A 9: 44,882,061 (GRCm39) D165V probably damaging Het
Cfap70 T C 14: 20,498,676 (GRCm39) T4A probably benign Het
Cilp TGGG TGG 9: 65,187,412 (GRCm39) probably null Het
Cntn4 C T 6: 106,330,673 (GRCm39) T97M probably benign Het
Crb1 CG C 1: 139,164,824 (GRCm39) probably null Het
Crim1 C T 17: 78,675,227 (GRCm39) T812I probably benign Het
Cyp39a1 T A 17: 43,993,941 (GRCm39) Y200* probably null Het
Dlg4 T G 11: 69,933,028 (GRCm39) I478S probably damaging Het
Dsc3 A T 18: 20,107,105 (GRCm39) N505K probably benign Het
Efhc1 T C 1: 21,043,049 (GRCm39) W323R probably damaging Het
Ehhadh T A 16: 21,581,520 (GRCm39) I491L probably benign Het
Ggt6 T G 11: 72,327,639 (GRCm39) H148Q possibly damaging Het
Gstm3 T C 3: 107,876,117 (GRCm39) D25G probably benign Het
Gtf2h3 G A 5: 124,740,231 (GRCm39) probably benign Het
Hjurp TGGG TTGCGGG 1: 88,194,002 (GRCm39) probably benign Het
Hnf4g A C 3: 3,716,674 (GRCm39) E281A probably damaging Het
Impg1 T G 9: 80,287,234 (GRCm39) E404A possibly damaging Het
Kcna2 T C 3: 107,012,715 (GRCm39) V432A probably benign Het
Map3k2 T G 18: 32,333,070 (GRCm39) D81E probably benign Het
Mmp1a TG TGG 9: 7,465,083 (GRCm38) probably null Het
Mmp9 T A 2: 164,792,726 (GRCm39) probably null Het
Mroh2a G A 1: 88,163,098 (GRCm39) R376H probably benign Het
Ms4a1 G T 19: 11,230,556 (GRCm39) T215N probably benign Het
Pam16 T C 16: 4,434,458 (GRCm39) I111V probably benign Het
Pde6c A G 19: 38,166,719 (GRCm39) T720A probably damaging Het
Pgap2 T C 7: 101,885,434 (GRCm39) L100P probably damaging Het
Ppl T A 16: 4,914,590 (GRCm39) S686C probably damaging Het
Rnls A G 19: 33,115,679 (GRCm39) probably benign Het
Robo3 A C 9: 37,333,824 (GRCm39) probably null Het
Rptn G A 3: 93,304,680 (GRCm39) G671D probably damaging Het
Slc6a21 C T 7: 44,937,592 (GRCm39) Q628* probably null Het
Smg6 T G 11: 74,823,252 (GRCm39) I708S probably damaging Het
Speer4c1 A C 5: 15,919,214 (GRCm39) probably benign Het
Thap1 C G 8: 26,652,498 (GRCm39) P79A probably benign Het
Vmn1r202 G A 13: 22,685,640 (GRCm39) T259I probably benign Het
Other mutations in Csmd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Csmd1 APN 8 16,059,297 (GRCm39) splice site probably benign
IGL00433:Csmd1 APN 8 16,281,387 (GRCm39) missense probably damaging 1.00
IGL00500:Csmd1 APN 8 15,971,139 (GRCm39) missense probably damaging 1.00
IGL00666:Csmd1 APN 8 16,240,004 (GRCm39) missense probably damaging 1.00
IGL00913:Csmd1 APN 8 16,121,301 (GRCm39) missense probably benign 0.00
IGL01012:Csmd1 APN 8 15,967,341 (GRCm39) missense probably benign 0.00
IGL01123:Csmd1 APN 8 17,584,944 (GRCm39) missense possibly damaging 0.96
IGL01348:Csmd1 APN 8 15,960,596 (GRCm39) missense probably damaging 0.99
IGL01444:Csmd1 APN 8 16,250,069 (GRCm39) missense probably benign 0.00
IGL01530:Csmd1 APN 8 15,953,195 (GRCm39) missense probably damaging 0.99
IGL01548:Csmd1 APN 8 16,338,660 (GRCm39) nonsense probably null
IGL01814:Csmd1 APN 8 16,551,389 (GRCm39) missense probably damaging 1.00
IGL01889:Csmd1 APN 8 16,048,857 (GRCm39) missense probably damaging 1.00
IGL02055:Csmd1 APN 8 16,119,015 (GRCm39) missense probably damaging 0.99
IGL02066:Csmd1 APN 8 15,976,594 (GRCm39) missense probably damaging 1.00
IGL02097:Csmd1 APN 8 16,261,773 (GRCm39) missense probably null 0.17
IGL02112:Csmd1 APN 8 16,131,719 (GRCm39) missense probably benign 0.18
IGL02161:Csmd1 APN 8 16,408,426 (GRCm39) missense probably damaging 0.97
IGL02189:Csmd1 APN 8 16,321,620 (GRCm39) missense probably damaging 0.99
IGL02272:Csmd1 APN 8 16,249,907 (GRCm39) missense probably damaging 0.99
IGL02292:Csmd1 APN 8 16,261,884 (GRCm39) missense probably damaging 1.00
IGL02385:Csmd1 APN 8 15,953,275 (GRCm39) missense probably benign 0.08
IGL02424:Csmd1 APN 8 16,142,340 (GRCm39) missense probably benign 0.22
IGL02492:Csmd1 APN 8 16,052,597 (GRCm39) missense probably benign 0.13
IGL02507:Csmd1 APN 8 17,584,992 (GRCm39) utr 5 prime probably benign
IGL02513:Csmd1 APN 8 16,049,869 (GRCm39) splice site probably benign
IGL02727:Csmd1 APN 8 16,281,341 (GRCm39) missense probably damaging 1.00
IGL02728:Csmd1 APN 8 16,049,779 (GRCm39) critical splice donor site probably null
IGL02852:Csmd1 APN 8 15,945,728 (GRCm39) missense probably damaging 0.99
IGL02935:Csmd1 APN 8 16,273,348 (GRCm39) missense probably damaging 1.00
IGL02945:Csmd1 APN 8 16,321,584 (GRCm39) missense possibly damaging 0.92
IGL02959:Csmd1 APN 8 15,960,465 (GRCm39) missense probably damaging 0.99
IGL03113:Csmd1 APN 8 16,078,712 (GRCm39) missense probably benign
IGL03129:Csmd1 APN 8 16,011,521 (GRCm39) missense probably damaging 0.99
IGL03131:Csmd1 APN 8 16,138,231 (GRCm39) missense probably damaging 1.00
IGL03275:Csmd1 APN 8 16,207,106 (GRCm39) missense probably benign 0.00
IGL03297:Csmd1 APN 8 16,059,432 (GRCm39) nonsense probably null
ikura UTSW 8 16,281,285 (GRCm39) missense probably damaging 1.00
I2289:Csmd1 UTSW 8 15,962,381 (GRCm39) missense probably benign 0.10
IGL03055:Csmd1 UTSW 8 16,145,515 (GRCm39) missense probably damaging 1.00
PIT4260001:Csmd1 UTSW 8 16,120,327 (GRCm39) missense probably damaging 1.00
PIT4378001:Csmd1 UTSW 8 15,945,728 (GRCm39) missense probably damaging 0.99
PIT4520001:Csmd1 UTSW 8 15,956,023 (GRCm39) missense probably benign 0.01
R0037:Csmd1 UTSW 8 15,967,248 (GRCm39) missense probably damaging 0.97
R0095:Csmd1 UTSW 8 16,283,065 (GRCm39) missense probably damaging 1.00
R0113:Csmd1 UTSW 8 16,034,849 (GRCm39) missense probably damaging 1.00
R0129:Csmd1 UTSW 8 16,129,956 (GRCm39) missense possibly damaging 0.95
R0144:Csmd1 UTSW 8 16,441,838 (GRCm39) missense probably benign 0.16
R0166:Csmd1 UTSW 8 16,283,036 (GRCm39) missense probably benign 0.29
R0227:Csmd1 UTSW 8 16,441,836 (GRCm39) missense probably benign 0.05
R0279:Csmd1 UTSW 8 16,273,249 (GRCm39) missense probably damaging 0.99
R0280:Csmd1 UTSW 8 16,321,616 (GRCm39) missense probably damaging 1.00
R0312:Csmd1 UTSW 8 16,034,760 (GRCm39) missense probably damaging 1.00
R0355:Csmd1 UTSW 8 15,968,330 (GRCm39) missense probably damaging 0.97
R0367:Csmd1 UTSW 8 15,967,270 (GRCm39) missense probably damaging 1.00
R0395:Csmd1 UTSW 8 16,396,652 (GRCm39) missense probably damaging 0.99
R0413:Csmd1 UTSW 8 16,760,530 (GRCm39) missense probably damaging 0.97
R0457:Csmd1 UTSW 8 16,551,407 (GRCm39) critical splice acceptor site probably null
R0463:Csmd1 UTSW 8 15,971,759 (GRCm39) missense probably damaging 0.99
R0482:Csmd1 UTSW 8 16,283,115 (GRCm39) missense probably damaging 1.00
R0501:Csmd1 UTSW 8 17,077,339 (GRCm39) missense probably damaging 0.97
R0505:Csmd1 UTSW 8 16,042,758 (GRCm39) missense probably damaging 1.00
R0507:Csmd1 UTSW 8 16,235,358 (GRCm39) splice site probably benign
R0511:Csmd1 UTSW 8 15,982,529 (GRCm39) missense possibly damaging 0.80
R0555:Csmd1 UTSW 8 16,235,287 (GRCm39) missense probably benign
R0580:Csmd1 UTSW 8 15,960,528 (GRCm39) missense probably damaging 1.00
R0610:Csmd1 UTSW 8 15,968,208 (GRCm39) missense possibly damaging 0.95
R0634:Csmd1 UTSW 8 16,276,405 (GRCm39) missense probably damaging 1.00
R0666:Csmd1 UTSW 8 16,119,063 (GRCm39) missense possibly damaging 0.88
R0674:Csmd1 UTSW 8 16,050,550 (GRCm39) missense probably benign 0.03
R0675:Csmd1 UTSW 8 16,208,145 (GRCm39) missense probably benign 0.01
R0763:Csmd1 UTSW 8 17,077,300 (GRCm39) missense possibly damaging 0.67
R0781:Csmd1 UTSW 8 15,971,174 (GRCm39) missense probably benign 0.35
R0862:Csmd1 UTSW 8 16,240,040 (GRCm39) missense probably damaging 0.99
R0864:Csmd1 UTSW 8 16,240,040 (GRCm39) missense probably damaging 0.99
R0925:Csmd1 UTSW 8 16,760,634 (GRCm39) missense probably benign 0.29
R0926:Csmd1 UTSW 8 16,083,590 (GRCm39) splice site probably null
R1005:Csmd1 UTSW 8 16,338,707 (GRCm39) missense probably damaging 0.99
R1073:Csmd1 UTSW 8 16,408,477 (GRCm39) splice site probably benign
R1185:Csmd1 UTSW 8 16,408,362 (GRCm39) missense probably damaging 0.96
R1185:Csmd1 UTSW 8 16,408,362 (GRCm39) missense probably damaging 0.96
R1185:Csmd1 UTSW 8 16,408,362 (GRCm39) missense probably damaging 0.96
R1256:Csmd1 UTSW 8 16,129,978 (GRCm39) missense probably damaging 1.00
R1294:Csmd1 UTSW 8 16,748,052 (GRCm39) missense probably damaging 0.99
R1375:Csmd1 UTSW 8 16,513,095 (GRCm39) splice site probably null
R1447:Csmd1 UTSW 8 15,975,306 (GRCm39) nonsense probably null
R1450:Csmd1 UTSW 8 15,995,180 (GRCm39) critical splice acceptor site probably null
R1470:Csmd1 UTSW 8 16,207,218 (GRCm39) splice site probably benign
R1580:Csmd1 UTSW 8 15,975,299 (GRCm39) missense probably damaging 1.00
R1591:Csmd1 UTSW 8 15,950,710 (GRCm39) missense probably damaging 0.99
R1658:Csmd1 UTSW 8 16,131,739 (GRCm39) missense possibly damaging 0.69
R1678:Csmd1 UTSW 8 15,968,252 (GRCm39) missense possibly damaging 0.58
R1717:Csmd1 UTSW 8 17,266,708 (GRCm39) missense possibly damaging 0.58
R1735:Csmd1 UTSW 8 15,982,610 (GRCm39) missense probably damaging 0.99
R1750:Csmd1 UTSW 8 15,967,303 (GRCm39) missense probably damaging 0.99
R1753:Csmd1 UTSW 8 16,207,134 (GRCm39) nonsense probably null
R1822:Csmd1 UTSW 8 16,273,340 (GRCm39) missense probably damaging 1.00
R1875:Csmd1 UTSW 8 15,979,101 (GRCm39) missense probably damaging 0.99
R1909:Csmd1 UTSW 8 15,956,116 (GRCm39) missense probably damaging 1.00
R1912:Csmd1 UTSW 8 16,284,012 (GRCm39) critical splice donor site probably null
R1993:Csmd1 UTSW 8 16,396,698 (GRCm39) missense probably damaging 0.99
R2067:Csmd1 UTSW 8 15,950,782 (GRCm39) missense probably benign
R2094:Csmd1 UTSW 8 16,129,992 (GRCm39) missense probably damaging 0.99
R2119:Csmd1 UTSW 8 17,266,749 (GRCm39) missense probably damaging 0.98
R2127:Csmd1 UTSW 8 15,967,392 (GRCm39) missense probably damaging 1.00
R2138:Csmd1 UTSW 8 15,979,088 (GRCm39) missense probably damaging 0.96
R2216:Csmd1 UTSW 8 17,077,355 (GRCm39) critical splice acceptor site probably null
R2220:Csmd1 UTSW 8 16,042,641 (GRCm39) missense possibly damaging 0.94
R2380:Csmd1 UTSW 8 16,240,101 (GRCm39) missense probably damaging 1.00
R2471:Csmd1 UTSW 8 16,261,776 (GRCm39) missense probably damaging 1.00
R2984:Csmd1 UTSW 8 16,003,782 (GRCm39) missense probably damaging 1.00
R3001:Csmd1 UTSW 8 16,246,184 (GRCm39) missense probably damaging 0.98
R3002:Csmd1 UTSW 8 16,246,184 (GRCm39) missense probably damaging 0.98
R3003:Csmd1 UTSW 8 16,246,184 (GRCm39) missense probably damaging 0.98
R3103:Csmd1 UTSW 8 15,967,405 (GRCm39) missense probably damaging 1.00
R3104:Csmd1 UTSW 8 17,077,247 (GRCm39) missense probably damaging 1.00
R3620:Csmd1 UTSW 8 16,042,684 (GRCm39) missense probably benign 0.29
R3621:Csmd1 UTSW 8 16,042,684 (GRCm39) missense probably benign 0.29
R3748:Csmd1 UTSW 8 15,956,071 (GRCm39) missense probably damaging 0.99
R3780:Csmd1 UTSW 8 16,252,000 (GRCm39) missense probably damaging 1.00
R3815:Csmd1 UTSW 8 16,052,522 (GRCm39) missense probably damaging 1.00
R3816:Csmd1 UTSW 8 16,052,522 (GRCm39) missense probably damaging 1.00
R3818:Csmd1 UTSW 8 16,052,522 (GRCm39) missense probably damaging 1.00
R3819:Csmd1 UTSW 8 16,052,522 (GRCm39) missense probably damaging 1.00
R3850:Csmd1 UTSW 8 16,129,936 (GRCm39) missense probably benign 0.00
R3945:Csmd1 UTSW 8 15,960,619 (GRCm39) splice site probably null
R3980:Csmd1 UTSW 8 15,956,056 (GRCm39) nonsense probably null
R4061:Csmd1 UTSW 8 15,995,158 (GRCm39) missense probably benign 0.00
R4086:Csmd1 UTSW 8 16,042,738 (GRCm39) missense probably damaging 0.99
R4087:Csmd1 UTSW 8 16,042,738 (GRCm39) missense probably damaging 0.99
R4089:Csmd1 UTSW 8 16,042,738 (GRCm39) missense probably damaging 0.99
R4183:Csmd1 UTSW 8 15,960,464 (GRCm39) missense probably damaging 0.99
R4226:Csmd1 UTSW 8 16,050,490 (GRCm39) missense probably damaging 0.99
R4454:Csmd1 UTSW 8 15,995,011 (GRCm39) missense probably damaging 0.99
R4533:Csmd1 UTSW 8 15,981,037 (GRCm39) splice site probably null
R4544:Csmd1 UTSW 8 16,760,652 (GRCm39) missense possibly damaging 0.93
R4547:Csmd1 UTSW 8 16,441,811 (GRCm39) missense possibly damaging 0.48
R4612:Csmd1 UTSW 8 15,971,908 (GRCm39) splice site probably null
R4620:Csmd1 UTSW 8 16,052,694 (GRCm39) critical splice acceptor site probably null
R4627:Csmd1 UTSW 8 16,747,933 (GRCm39) missense probably benign 0.00
R4633:Csmd1 UTSW 8 16,052,620 (GRCm39) missense probably damaging 0.99
R4646:Csmd1 UTSW 8 15,982,511 (GRCm39) missense possibly damaging 0.87
R4648:Csmd1 UTSW 8 16,048,788 (GRCm39) nonsense probably null
R4668:Csmd1 UTSW 8 16,073,905 (GRCm39) missense possibly damaging 0.50
R4709:Csmd1 UTSW 8 16,760,522 (GRCm39) critical splice donor site probably null
R4709:Csmd1 UTSW 8 16,073,905 (GRCm39) missense possibly damaging 0.96
R4741:Csmd1 UTSW 8 15,960,447 (GRCm39) missense probably damaging 0.99
R4774:Csmd1 UTSW 8 16,059,369 (GRCm39) missense probably benign 0.11
R4793:Csmd1 UTSW 8 16,138,277 (GRCm39) missense probably damaging 1.00
R4829:Csmd1 UTSW 8 16,177,310 (GRCm39) missense probably damaging 1.00
R4888:Csmd1 UTSW 8 15,945,674 (GRCm39) utr 3 prime probably benign
R4896:Csmd1 UTSW 8 16,059,439 (GRCm39) missense probably benign 0.00
R4932:Csmd1 UTSW 8 16,073,779 (GRCm39) missense probably damaging 0.99
R4944:Csmd1 UTSW 8 16,048,772 (GRCm39) missense probably damaging 1.00
R4953:Csmd1 UTSW 8 16,249,931 (GRCm39) missense probably damaging 0.99
R4996:Csmd1 UTSW 8 15,960,452 (GRCm39) missense probably damaging 0.97
R5028:Csmd1 UTSW 8 16,039,090 (GRCm39) missense probably damaging 1.00
R5146:Csmd1 UTSW 8 16,246,204 (GRCm39) missense probably damaging 1.00
R5272:Csmd1 UTSW 8 16,249,958 (GRCm39) missense probably damaging 0.99
R5327:Csmd1 UTSW 8 17,266,728 (GRCm39) missense possibly damaging 0.94
R5399:Csmd1 UTSW 8 16,760,613 (GRCm39) missense probably damaging 1.00
R5411:Csmd1 UTSW 8 15,960,471 (GRCm39) missense probably damaging 1.00
R5462:Csmd1 UTSW 8 16,011,486 (GRCm39) missense probably benign 0.12
R5463:Csmd1 UTSW 8 16,034,860 (GRCm39) missense probably benign 0.34
R5497:Csmd1 UTSW 8 16,135,195 (GRCm39) missense probably benign 0.20
R5536:Csmd1 UTSW 8 16,338,674 (GRCm39) missense probably damaging 0.99
R5711:Csmd1 UTSW 8 16,003,703 (GRCm39) missense probably damaging 1.00
R5730:Csmd1 UTSW 8 16,235,206 (GRCm39) nonsense probably null
R5788:Csmd1 UTSW 8 16,251,980 (GRCm39) missense probably damaging 1.00
R5941:Csmd1 UTSW 8 15,982,471 (GRCm39) missense probably damaging 0.99
R5960:Csmd1 UTSW 8 16,121,430 (GRCm39) missense possibly damaging 0.68
R5961:Csmd1 UTSW 8 16,120,366 (GRCm39) missense probably damaging 0.99
R5969:Csmd1 UTSW 8 16,121,367 (GRCm39) missense probably benign 0.00
R5998:Csmd1 UTSW 8 15,960,443 (GRCm39) missense probably damaging 1.00
R6062:Csmd1 UTSW 8 16,142,319 (GRCm39) missense possibly damaging 0.68
R6109:Csmd1 UTSW 8 16,249,874 (GRCm39) missense possibly damaging 0.93
R6116:Csmd1 UTSW 8 16,261,864 (GRCm39) missense probably damaging 1.00
R6143:Csmd1 UTSW 8 16,138,315 (GRCm39) missense probably damaging 1.00
R6155:Csmd1 UTSW 8 15,953,231 (GRCm39) missense probably benign 0.01
R6197:Csmd1 UTSW 8 15,976,611 (GRCm39) missense probably benign 0.32
R6247:Csmd1 UTSW 8 16,246,249 (GRCm39) missense possibly damaging 0.91
R6304:Csmd1 UTSW 8 16,108,688 (GRCm39) missense probably damaging 1.00
R6317:Csmd1 UTSW 8 16,760,658 (GRCm39) missense possibly damaging 0.89
R6318:Csmd1 UTSW 8 15,953,212 (GRCm39) missense probably damaging 1.00
R6338:Csmd1 UTSW 8 15,982,492 (GRCm39) missense possibly damaging 0.75
R6369:Csmd1 UTSW 8 17,585,020 (GRCm39) start gained probably benign
R6447:Csmd1 UTSW 8 15,960,527 (GRCm39) missense probably damaging 1.00
R6454:Csmd1 UTSW 8 15,971,150 (GRCm39) missense probably damaging 0.99
R6494:Csmd1 UTSW 8 16,261,709 (GRCm39) splice site probably null
R6614:Csmd1 UTSW 8 17,266,803 (GRCm39) missense probably damaging 1.00
R6736:Csmd1 UTSW 8 16,052,626 (GRCm39) missense probably damaging 0.99
R6769:Csmd1 UTSW 8 16,121,408 (GRCm39) missense possibly damaging 0.80
R6771:Csmd1 UTSW 8 16,121,408 (GRCm39) missense possibly damaging 0.80
R6804:Csmd1 UTSW 8 16,087,260 (GRCm39) missense probably damaging 1.00
R6818:Csmd1 UTSW 8 16,235,341 (GRCm39) missense probably damaging 1.00
R6863:Csmd1 UTSW 8 17,584,929 (GRCm39) missense possibly damaging 0.85
R6930:Csmd1 UTSW 8 16,142,409 (GRCm39) missense probably damaging 0.97
R6969:Csmd1 UTSW 8 17,266,805 (GRCm39) missense possibly damaging 0.94
R7112:Csmd1 UTSW 8 16,151,142 (GRCm39) missense probably damaging 1.00
R7124:Csmd1 UTSW 8 15,953,202 (GRCm39) missense probably damaging 1.00
R7167:Csmd1 UTSW 8 15,976,524 (GRCm39) missense probably benign
R7243:Csmd1 UTSW 8 15,965,357 (GRCm39) missense probably damaging 1.00
R7260:Csmd1 UTSW 8 16,050,574 (GRCm39) missense probably damaging 1.00
R7271:Csmd1 UTSW 8 17,077,295 (GRCm39) missense probably damaging 0.99
R7324:Csmd1 UTSW 8 16,108,721 (GRCm39) missense probably damaging 1.00
R7325:Csmd1 UTSW 8 16,108,721 (GRCm39) missense probably damaging 1.00
R7327:Csmd1 UTSW 8 16,108,721 (GRCm39) missense probably damaging 1.00
R7373:Csmd1 UTSW 8 16,042,713 (GRCm39) missense probably damaging 1.00
R7406:Csmd1 UTSW 8 16,338,707 (GRCm39) missense probably damaging 0.99
R7427:Csmd1 UTSW 8 16,073,864 (GRCm39) missense possibly damaging 0.91
R7428:Csmd1 UTSW 8 16,073,864 (GRCm39) missense possibly damaging 0.91
R7445:Csmd1 UTSW 8 16,208,268 (GRCm39) missense possibly damaging 0.61
R7458:Csmd1 UTSW 8 16,003,738 (GRCm39) missense probably damaging 1.00
R7476:Csmd1 UTSW 8 15,945,731 (GRCm39) missense probably damaging 1.00
R7527:Csmd1 UTSW 8 16,261,732 (GRCm39) missense probably damaging 1.00
R7544:Csmd1 UTSW 8 16,142,310 (GRCm39) missense probably damaging 1.00
R7583:Csmd1 UTSW 8 16,048,833 (GRCm39) missense probably damaging 0.96
R7603:Csmd1 UTSW 8 16,338,696 (GRCm39) missense probably damaging 1.00
R7607:Csmd1 UTSW 8 15,968,331 (GRCm39) missense possibly damaging 0.94
R7642:Csmd1 UTSW 8 16,135,192 (GRCm39) missense probably damaging 0.99
R7669:Csmd1 UTSW 8 15,967,273 (GRCm39) missense probably damaging 1.00
R7720:Csmd1 UTSW 8 15,981,108 (GRCm39) missense probably damaging 1.00
R7728:Csmd1 UTSW 8 16,281,285 (GRCm39) missense probably damaging 1.00
R7738:Csmd1 UTSW 8 16,151,004 (GRCm39) missense probably damaging 1.00
R7745:Csmd1 UTSW 8 15,982,461 (GRCm39) critical splice donor site probably null
R7879:Csmd1 UTSW 8 16,441,820 (GRCm39) missense probably benign 0.28
R7884:Csmd1 UTSW 8 16,011,418 (GRCm39) missense probably damaging 1.00
R7897:Csmd1 UTSW 8 17,584,935 (GRCm39) missense possibly damaging 0.96
R8111:Csmd1 UTSW 8 15,967,306 (GRCm39) missense probably benign
R8119:Csmd1 UTSW 8 17,077,310 (GRCm39) missense probably damaging 0.99
R8134:Csmd1 UTSW 8 15,982,550 (GRCm39) missense probably damaging 0.99
R8187:Csmd1 UTSW 8 16,177,188 (GRCm39) missense probably damaging 0.99
R8196:Csmd1 UTSW 8 16,059,468 (GRCm39) missense probably benign 0.18
R8231:Csmd1 UTSW 8 16,747,939 (GRCm39) missense possibly damaging 0.82
R8242:Csmd1 UTSW 8 16,760,670 (GRCm39) missense probably benign 0.42
R8274:Csmd1 UTSW 8 15,960,453 (GRCm39) missense possibly damaging 0.93
R8286:Csmd1 UTSW 8 16,039,188 (GRCm39) missense probably benign 0.18
R8289:Csmd1 UTSW 8 16,108,716 (GRCm39) missense probably damaging 0.99
R8314:Csmd1 UTSW 8 16,208,258 (GRCm39) missense probably benign
R8323:Csmd1 UTSW 8 17,266,751 (GRCm39) nonsense probably null
R8387:Csmd1 UTSW 8 16,050,484 (GRCm39) missense possibly damaging 0.94
R8413:Csmd1 UTSW 8 15,950,676 (GRCm39) missense probably damaging 0.98
R8672:Csmd1 UTSW 8 15,976,598 (GRCm39) missense probably benign 0.01
R8765:Csmd1 UTSW 8 16,760,627 (GRCm39) nonsense probably null
R8789:Csmd1 UTSW 8 17,266,722 (GRCm39) missense probably damaging 0.99
R8828:Csmd1 UTSW 8 16,048,794 (GRCm39) missense probably benign 0.00
R8858:Csmd1 UTSW 8 16,120,318 (GRCm39) missense probably benign 0.10
R8878:Csmd1 UTSW 8 15,960,528 (GRCm39) missense probably damaging 1.00
R8911:Csmd1 UTSW 8 16,748,019 (GRCm39) missense probably damaging 0.99
R8966:Csmd1 UTSW 8 16,250,059 (GRCm39) missense probably damaging 1.00
R8978:Csmd1 UTSW 8 15,971,056 (GRCm39) missense probably benign 0.37
R8996:Csmd1 UTSW 8 15,971,105 (GRCm39) missense possibly damaging 0.54
R9045:Csmd1 UTSW 8 16,284,088 (GRCm39) missense probably damaging 0.99
R9084:Csmd1 UTSW 8 16,138,325 (GRCm39) missense probably benign
R9124:Csmd1 UTSW 8 16,034,806 (GRCm39) missense probably damaging 0.99
R9127:Csmd1 UTSW 8 16,273,286 (GRCm39) missense probably benign 0.31
R9146:Csmd1 UTSW 8 16,048,832 (GRCm39) missense probably benign 0.00
R9198:Csmd1 UTSW 8 15,962,430 (GRCm39) missense probably damaging 1.00
R9285:Csmd1 UTSW 8 15,956,088 (GRCm39) missense probably damaging 1.00
R9303:Csmd1 UTSW 8 16,011,532 (GRCm39) missense probably benign 0.31
R9305:Csmd1 UTSW 8 16,011,532 (GRCm39) missense probably benign 0.31
R9326:Csmd1 UTSW 8 16,049,803 (GRCm39) missense probably benign 0.21
R9356:Csmd1 UTSW 8 16,252,069 (GRCm39) missense probably damaging 1.00
R9385:Csmd1 UTSW 8 16,034,756 (GRCm39) missense probably benign 0.19
R9444:Csmd1 UTSW 8 16,208,250 (GRCm39) missense probably benign 0.30
R9476:Csmd1 UTSW 8 15,981,215 (GRCm39) critical splice acceptor site probably null
R9506:Csmd1 UTSW 8 16,250,023 (GRCm39) missense probably damaging 1.00
R9614:Csmd1 UTSW 8 16,208,239 (GRCm39) missense probably benign 0.00
R9668:Csmd1 UTSW 8 16,261,772 (GRCm39) missense probably benign 0.00
X0011:Csmd1 UTSW 8 16,246,277 (GRCm39) missense probably damaging 1.00
X0021:Csmd1 UTSW 8 16,235,270 (GRCm39) missense probably damaging 1.00
X0024:Csmd1 UTSW 8 16,087,232 (GRCm39) missense probably damaging 0.99
X0028:Csmd1 UTSW 8 15,965,333 (GRCm39) missense possibly damaging 0.79
Z1088:Csmd1 UTSW 8 16,239,992 (GRCm39) missense possibly damaging 0.50
Z1088:Csmd1 UTSW 8 16,142,272 (GRCm39) missense probably damaging 1.00
Z1088:Csmd1 UTSW 8 15,971,875 (GRCm39) missense possibly damaging 0.91
Z1088:Csmd1 UTSW 8 16,396,631 (GRCm39) missense probably damaging 0.99
Z1088:Csmd1 UTSW 8 16,250,072 (GRCm39) missense probably damaging 0.97
Z1176:Csmd1 UTSW 8 16,087,212 (GRCm39) missense probably damaging 1.00
Z1176:Csmd1 UTSW 8 16,048,814 (GRCm39) missense probably damaging 1.00
Z1177:Csmd1 UTSW 8 16,250,033 (GRCm39) missense probably damaging 1.00
Z1177:Csmd1 UTSW 8 16,034,708 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTGGCCAGATTCAGCAAG -3'
(R):5'- AGCAGACTAGACCTCTTAGCC -3'

Sequencing Primer
(F):5'- CCCATACTATGATTCATTCTCAAGG -3'
(R):5'- AGCCTAGCAGATATCCTTGCCG -3'
Posted On 2017-01-31