Incidental Mutation 'IGL03097:Cilp'
ID453222
Institutional Source Beutler Lab
Gene Symbol Cilp
Ensembl Gene ENSMUSG00000042254
Gene Namecartilage intermediate layer protein, nucleotide pyrophosphohydrolase
SynonymsC130036G17Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #IGL03097 (G1)
Quality Score214
Status Validated
Chromosome9
Chromosomal Location65265180-65280605 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TGGG to TGG at 65280130 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000036631 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048762] [ENSMUST00000141382]
Predicted Effect probably null
Transcript: ENSMUST00000048762
SMART Domains Protein: ENSMUSP00000036631
Gene: ENSMUSG00000042254

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Mucin2_WxxW 55 139 1.9e-24 PFAM
TSP1 152 201 3.09e-10 SMART
low complexity region 233 242 N/A INTRINSIC
IGc2 321 383 4.45e-10 SMART
low complexity region 1154 1170 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141382
SMART Domains Protein: ENSMUSP00000121326
Gene: ENSMUSG00000042254

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 90% (46/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Major alterations in the composition of the cartilage extracellular matrix occur in joint disease, such as osteoarthrosis. This gene encodes the cartilage intermediate layer protein (CILP), which increases in early osteoarthrosis cartilage. The encoded protein was thought to encode a protein precursor for two different proteins; an N-terminal CILP and a C-terminal homolog of NTPPHase, however, later studies identified no nucleotide pyrophosphatase phosphodiesterase (NPP) activity. The full-length and the N-terminal domain of this protein was shown to function as an IGF-1 antagonist. An allelic variant of this gene has been associated with lumbar disc disease. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Adcy9 T C 16: 4,418,066 T257A possibly damaging Het
Ahnak A G 19: 9,002,387 D345G probably benign Het
Ak5 A G 3: 152,660,514 probably null Het
Akap3 A G 6: 126,866,416 K666R probably damaging Het
Alpk3 A G 7: 81,093,909 N1158S probably benign Het
Atp23 A T 10: 126,887,687 V182E probably damaging Het
Atp4a A G 7: 30,723,037 D898G probably benign Het
Bnip3 T C 7: 138,894,479 N140S probably damaging Het
Bptf T C 11: 107,077,680 Y1059C probably damaging Het
Cacna1h A T 17: 25,391,144 I796N probably damaging Het
Ccnb2 A G 9: 70,409,396 probably benign Het
Cd3g T A 9: 44,970,763 D165V probably damaging Het
Cfap70 T C 14: 20,448,608 T4A probably benign Het
Cntn4 C T 6: 106,353,712 T97M probably benign Het
Crb1 CG C 1: 139,237,086 probably null Het
Crim1 C T 17: 78,367,798 T812I probably benign Het
Csmd1 G T 8: 15,945,127 T2636K probably damaging Het
Cyp39a1 T A 17: 43,683,050 Y200* probably null Het
Dlg4 T G 11: 70,042,202 I478S probably damaging Het
Dsc3 A T 18: 19,974,048 N505K probably benign Het
Efhc1 T C 1: 20,972,825 W323R probably damaging Het
Ehhadh T A 16: 21,762,770 I491L probably benign Het
Ggt6 T G 11: 72,436,813 H148Q possibly damaging Het
Gstm3 T C 3: 107,968,801 D25G probably benign Het
Gtf2h3 G A 5: 124,602,168 probably benign Het
Hjurp TGGG TTGCGGG 1: 88,266,280 probably benign Het
Hnf4g A C 3: 3,651,614 E281A probably damaging Het
Impg1 T G 9: 80,379,952 E404A possibly damaging Het
Kcna2 T C 3: 107,105,399 V432A probably benign Het
Map3k2 T G 18: 32,200,017 D81E probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mmp9 T A 2: 164,950,806 probably null Het
Mroh2a G A 1: 88,235,376 R376H probably benign Het
Ms4a1 G T 19: 11,253,192 T215N probably benign Het
Pam16 T C 16: 4,616,594 I111V probably benign Het
Pde6c A G 19: 38,178,271 T720A probably damaging Het
Pgap2 T C 7: 102,236,227 L100P probably damaging Het
Ppl T A 16: 5,096,726 S686C probably damaging Het
Rnls A G 19: 33,138,279 probably benign Het
Robo3 A C 9: 37,422,528 probably null Het
Rptn G A 3: 93,397,373 G671D probably damaging Het
Slc6a21 C T 7: 45,288,168 Q628* probably null Het
Smg6 T G 11: 74,932,426 I708S probably damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Thap1 C G 8: 26,162,470 P79A probably benign Het
Vmn1r202 G A 13: 22,501,470 T259I probably benign Het
Other mutations in Cilp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01291:Cilp APN 9 65278983 missense possibly damaging 0.80
IGL01340:Cilp APN 9 65275974 missense probably damaging 0.99
IGL02330:Cilp APN 9 65274522 splice site probably benign
IGL02729:Cilp APN 9 65278090 missense possibly damaging 0.63
IGL02833:Cilp APN 9 65277924 missense probably benign
IGL02961:Cilp APN 9 65278609 missense possibly damaging 0.88
IGL03137:Cilp APN 9 65278168 missense probably benign
IGL03211:Cilp APN 9 65280175 missense probably benign
IGL03301:Cilp APN 9 65280217 missense probably benign 0.01
IGL03341:Cilp APN 9 65278002 missense probably benign 0.07
ANU05:Cilp UTSW 9 65278983 missense possibly damaging 0.80
IGL02984:Cilp UTSW 9 65280130 frame shift probably null
IGL02988:Cilp UTSW 9 65280130 frame shift probably null
IGL02991:Cilp UTSW 9 65280130 frame shift probably null
IGL03014:Cilp UTSW 9 65280130 frame shift probably null
IGL03050:Cilp UTSW 9 65280130 frame shift probably null
IGL03054:Cilp UTSW 9 65280130 frame shift probably null
IGL03055:Cilp UTSW 9 65280130 frame shift probably null
IGL03098:Cilp UTSW 9 65280130 frame shift probably null
IGL03134:Cilp UTSW 9 65280130 frame shift probably null
IGL03138:Cilp UTSW 9 65280130 frame shift probably null
IGL03147:Cilp UTSW 9 65280130 frame shift probably null
R0096:Cilp UTSW 9 65273670 missense possibly damaging 0.57
R0219:Cilp UTSW 9 65269590 missense possibly damaging 0.64
R0347:Cilp UTSW 9 65280153 missense probably benign
R0699:Cilp UTSW 9 65270326 missense probably damaging 1.00
R1148:Cilp UTSW 9 65280316 missense possibly damaging 0.96
R1148:Cilp UTSW 9 65280316 missense possibly damaging 0.96
R1155:Cilp UTSW 9 65269587 missense probably benign 0.01
R1544:Cilp UTSW 9 65275845 missense probably benign 0.03
R1584:Cilp UTSW 9 65279715 missense probably damaging 1.00
R1586:Cilp UTSW 9 65279715 missense probably damaging 1.00
R2055:Cilp UTSW 9 65279715 missense probably damaging 1.00
R2069:Cilp UTSW 9 65278090 missense possibly damaging 0.63
R2070:Cilp UTSW 9 65279095 missense probably damaging 1.00
R2414:Cilp UTSW 9 65274645 splice site probably benign
R4284:Cilp UTSW 9 65278278 missense probably damaging 1.00
R4630:Cilp UTSW 9 65279880 missense probably benign 0.17
R4632:Cilp UTSW 9 65279880 missense probably benign 0.17
R4870:Cilp UTSW 9 65279698 missense probably damaging 1.00
R4908:Cilp UTSW 9 65278020 missense probably benign 0.17
R5568:Cilp UTSW 9 65280233 missense probably benign 0.04
R5621:Cilp UTSW 9 65278791 missense possibly damaging 0.71
R5889:Cilp UTSW 9 65280343 missense possibly damaging 0.93
R6645:Cilp UTSW 9 65279305 missense possibly damaging 0.66
R6878:Cilp UTSW 9 65279847 missense probably damaging 1.00
R6982:Cilp UTSW 9 65279805 missense probably damaging 1.00
R7330:Cilp UTSW 9 65280245 missense probably benign
X0024:Cilp UTSW 9 65279643 missense probably damaging 1.00
X0025:Cilp UTSW 9 65279698 missense probably damaging 1.00
Z1088:Cilp UTSW 9 65280130 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GGCTCCTCCAGAATCATGAAGAG -3'
(R):5'- ATCAGCATCATGAGGCAGAG -3'

Sequencing Primer
(F):5'- CCTCCAGAATCATGAAGAGCAATGTG -3'
(R):5'- CATCATGAGGCAGAGACAGTAAG -3'
Posted On2017-01-31