Mutagenetix > Incidental Mutation

Incidental Mutation 'IGL03097:Cilp'

453222

Institutional Source

Beutler Lab

Gene Symbol

Cilp

Ensembl Gene

ENSMUSG00000042254

Gene Name

cartilage intermediate layer protein, nucleotide pyrophosphohydrolase

Synonyms

C130036G17Rik

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

IGL03097 (G1)

Quality Score

214

Status

Validated

Chromosome

Chromosomal Location

65265180-65280605 bp(+) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

TGGG to TGG at 65280130 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000036631 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048762] [ENSMUST00000141382]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000048762

SMART Domains

Protein: ENSMUSP00000036631
Gene: ENSMUSG00000042254

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:Mucin2_WxxW	55	139	1.9e-24	PFAM
TSP1	152	201	3.09e-10	SMART
low complexity region	233	242	N/A	INTRINSIC
IGc2	321	383	4.45e-10	SMART
low complexity region	1154	1170	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000141382

SMART Domains

Protein: ENSMUSP00000121326
Gene: ENSMUSG00000042254

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC

Coding Region Coverage

1x: 0.0%
3x: 0.0%
10x: 0.0%
20x: 0.0%

Validation Efficiency

90% (46/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Major alterations in the composition of the cartilage extracellular matrix occur in joint disease, such as osteoarthrosis. This gene encodes the cartilage intermediate layer protein (CILP), which increases in early osteoarthrosis cartilage. The encoded protein was thought to encode a protein precursor for two different proteins; an N-terminal CILP and a C-terminal homolog of NTPPHase, however, later studies identified no nucleotide pyrophosphatase phosphodiesterase (NPP) activity. The full-length and the N-terminal domain of this protein was shown to function as an IGF-1 antagonist. An allelic variant of this gene has been associated with lumbar disc disease. [provided by RefSeq, Sep 2010]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933416I08Rik	TCC	TCCC	X: 53,690,895		noncoding transcript	Het
Adcy9	T	C	16: 4,418,066	T257A	possibly damaging	Het
Ahnak	A	G	19: 9,002,387	D345G	probably benign	Het
Ak5	A	G	3: 152,660,514		probably null	Het
Akap3	A	G	6: 126,866,416	K666R	probably damaging	Het
Alpk3	A	G	7: 81,093,909	N1158S	probably benign	Het
Atp23	A	T	10: 126,887,687	V182E	probably damaging	Het
Atp4a	A	G	7: 30,723,037	D898G	probably benign	Het
Bnip3	T	C	7: 138,894,479	N140S	probably damaging	Het
Bptf	T	C	11: 107,077,680	Y1059C	probably damaging	Het
Cacna1h	A	T	17: 25,391,144	I796N	probably damaging	Het
Ccnb2	A	G	9: 70,409,396		probably benign	Het
Cd3g	T	A	9: 44,970,763	D165V	probably damaging	Het
Cfap70	T	C	14: 20,448,608	T4A	probably benign	Het
Cntn4	C	T	6: 106,353,712	T97M	probably benign	Het
Crb1	CG	C	1: 139,237,086		probably null	Het
Crim1	C	T	17: 78,367,798	T812I	probably benign	Het
Csmd1	G	T	8: 15,945,127	T2636K	probably damaging	Het
Cyp39a1	T	A	17: 43,683,050	Y200*	probably null	Het
Dlg4	T	G	11: 70,042,202	I478S	probably damaging	Het
Dsc3	A	T	18: 19,974,048	N505K	probably benign	Het
Efhc1	T	C	1: 20,972,825	W323R	probably damaging	Het
Ehhadh	T	A	16: 21,762,770	I491L	probably benign	Het
Ggt6	T	G	11: 72,436,813	H148Q	possibly damaging	Het
Gstm3	T	C	3: 107,968,801	D25G	probably benign	Het
Gtf2h3	G	A	5: 124,602,168		probably benign	Het
Hjurp	TGGG	TTGCGGG	1: 88,266,280		probably benign	Het
Hnf4g	A	C	3: 3,651,614	E281A	probably damaging	Het
Impg1	T	G	9: 80,379,952	E404A	possibly damaging	Het
Kcna2	T	C	3: 107,105,399	V432A	probably benign	Het
Map3k2	T	G	18: 32,200,017	D81E	probably benign	Het
Mmp1a	TG	TGG	9: 7,465,083		probably null	Het
Mmp9	T	A	2: 164,950,806		probably null	Het
Mroh2a	G	A	1: 88,235,376	R376H	probably benign	Het
Ms4a1	G	T	19: 11,253,192	T215N	probably benign	Het
Pam16	T	C	16: 4,616,594	I111V	probably benign	Het
Pde6c	A	G	19: 38,178,271	T720A	probably damaging	Het
Pgap2	T	C	7: 102,236,227	L100P	probably damaging	Het
Ppl	T	A	16: 5,096,726	S686C	probably damaging	Het
Rnls	A	G	19: 33,138,279		probably benign	Het
Robo3	A	C	9: 37,422,528		probably null	Het
Rptn	G	A	3: 93,397,373	G671D	probably damaging	Het
Slc6a21	C	T	7: 45,288,168	Q628*	probably null	Het
Smg6	T	G	11: 74,932,426	I708S	probably damaging	Het
Speer4c	A	C	5: 15,714,216		probably benign	Het
Thap1	C	G	8: 26,162,470	P79A	probably benign	Het
Vmn1r202	G	A	13: 22,501,470	T259I	probably benign	Het

Other mutations in Cilp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01291:Cilp	APN	9	65278983	missense	possibly damaging	0.80
IGL01340:Cilp	APN	9	65275974	missense	probably damaging	0.99
IGL02330:Cilp	APN	9	65274522	splice site	probably benign
IGL02729:Cilp	APN	9	65278090	missense	possibly damaging	0.63
IGL02833:Cilp	APN	9	65277924	missense	probably benign
IGL02961:Cilp	APN	9	65278609	missense	possibly damaging	0.88
IGL03137:Cilp	APN	9	65278168	missense	probably benign
IGL03211:Cilp	APN	9	65280175	missense	probably benign
IGL03301:Cilp	APN	9	65280217	missense	probably benign	0.01
IGL03341:Cilp	APN	9	65278002	missense	probably benign	0.07
ANU05:Cilp	UTSW	9	65278983	missense	possibly damaging	0.80
IGL02984:Cilp	UTSW	9	65280130	frame shift	probably null
IGL02988:Cilp	UTSW	9	65280130	frame shift	probably null
IGL02991:Cilp	UTSW	9	65280130	frame shift	probably null
IGL03014:Cilp	UTSW	9	65280130	frame shift	probably null
IGL03050:Cilp	UTSW	9	65280130	frame shift	probably null
IGL03054:Cilp	UTSW	9	65280130	frame shift	probably null
IGL03055:Cilp	UTSW	9	65280130	frame shift	probably null
IGL03098:Cilp	UTSW	9	65280130	frame shift	probably null
IGL03134:Cilp	UTSW	9	65280130	frame shift	probably null
IGL03138:Cilp	UTSW	9	65280130	frame shift	probably null
IGL03147:Cilp	UTSW	9	65280130	frame shift	probably null
R0096:Cilp	UTSW	9	65273670	missense	possibly damaging	0.57
R0219:Cilp	UTSW	9	65269590	missense	possibly damaging	0.64
R0347:Cilp	UTSW	9	65280153	missense	probably benign
R0699:Cilp	UTSW	9	65270326	missense	probably damaging	1.00
R1148:Cilp	UTSW	9	65280316	missense	possibly damaging	0.96
R1148:Cilp	UTSW	9	65280316	missense	possibly damaging	0.96
R1155:Cilp	UTSW	9	65269587	missense	probably benign	0.01
R1544:Cilp	UTSW	9	65275845	missense	probably benign	0.03
R1584:Cilp	UTSW	9	65279715	missense	probably damaging	1.00
R1586:Cilp	UTSW	9	65279715	missense	probably damaging	1.00
R2055:Cilp	UTSW	9	65279715	missense	probably damaging	1.00
R2069:Cilp	UTSW	9	65278090	missense	possibly damaging	0.63
R2070:Cilp	UTSW	9	65279095	missense	probably damaging	1.00
R2414:Cilp	UTSW	9	65274645	splice site	probably benign
R4284:Cilp	UTSW	9	65278278	missense	probably damaging	1.00
R4630:Cilp	UTSW	9	65279880	missense	probably benign	0.17
R4632:Cilp	UTSW	9	65279880	missense	probably benign	0.17
R4870:Cilp	UTSW	9	65279698	missense	probably damaging	1.00
R4908:Cilp	UTSW	9	65278020	missense	probably benign	0.17
R5568:Cilp	UTSW	9	65280233	missense	probably benign	0.04
R5621:Cilp	UTSW	9	65278791	missense	possibly damaging	0.71
R5889:Cilp	UTSW	9	65280343	missense	possibly damaging	0.93
R6645:Cilp	UTSW	9	65279305	missense	possibly damaging	0.66
R6878:Cilp	UTSW	9	65279847	missense	probably damaging	1.00
R6982:Cilp	UTSW	9	65279805	missense	probably damaging	1.00
R7330:Cilp	UTSW	9	65280245	missense	probably benign
R7967:Cilp	UTSW	9	65278212	missense	possibly damaging	0.80
R8305:Cilp	UTSW	9	65279004	missense	probably damaging	0.98
R8306:Cilp	UTSW	9	65279004	missense	probably damaging	0.98
R8307:Cilp	UTSW	9	65279004	missense	probably damaging	0.98
R8308:Cilp	UTSW	9	65279004	missense	probably damaging	0.98
R8386:Cilp	UTSW	9	65279004	missense	probably damaging	0.98
R8407:Cilp	UTSW	9	65274616	missense	probably damaging	1.00
R8542:Cilp	UTSW	9	65278123	missense	probably damaging	1.00
R8794:Cilp	UTSW	9	65279253	missense	probably benign	0.26
R8951:Cilp	UTSW	9	65272938	missense	probably benign	0.01
R9060:Cilp	UTSW	9	65279020	missense	probably benign	0.01
R9257:Cilp	UTSW	9	65267169	missense	possibly damaging	0.72
R9265:Cilp	UTSW	9	65280051	missense	probably benign
R9358:Cilp	UTSW	9	65275987	missense	probably benign
R9401:Cilp	UTSW	9	65278099	missense	probably damaging	0.98
X0024:Cilp	UTSW	9	65279643	missense	probably damaging	1.00
X0025:Cilp	UTSW	9	65279698	missense	probably damaging	1.00
Z1088:Cilp	UTSW	9	65280130	frame shift	probably null
Z1176:Cilp	UTSW	9	65280130	frame shift	probably null
Z1177:Cilp	UTSW	9	65280130	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- GGCTCCTCCAGAATCATGAAGAG -3'
(R):5'- ATCAGCATCATGAGGCAGAG -3'

Sequencing Primer
(F):5'- CCTCCAGAATCATGAAGAGCAATGTG -3'
(R):5'- CATCATGAGGCAGAGACAGTAAG -3'

Posted On

2017-01-31