Mutagenetix > Incidental Mutation

Incidental Mutation 'IGL03097:Smg6'

453229

Institutional Source

Beutler Lab

Gene Symbol

Smg6

Ensembl Gene

ENSMUSG00000038290

Gene Name

Smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans)

Synonyms

Accession Numbers

Genbank: NM_001002764.1; Ensembl: ENSMUST00000045281

Essential gene?

Essential (E-score: 1.000) question?

Stock #

IGL03097 (G1)

Quality Score

211

Status

Validated

Chromosome

Chromosomal Location

74925823-75164448 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 74932426 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Serine at position 708 (I708S)

Ref Sequence

ENSEMBL: ENSMUSP00000043555 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045281]

AlphaFold

P61406

Predicted Effect

probably damaging
Transcript: ENSMUST00000045281
AA Change: I708S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000043555
Gene: ENSMUSG00000038290
AA Change: I708S

Domain	Start	End	E-Value	Type
internal_repeat_1	42	99	7.68e-6	PROSPERO
internal_repeat_1	135	188	7.68e-6	PROSPERO
low complexity region	212	227	N/A	INTRINSIC
low complexity region	257	271	N/A	INTRINSIC
low complexity region	376	390	N/A	INTRINSIC
low complexity region	417	426	N/A	INTRINSIC
low complexity region	436	453	N/A	INTRINSIC
low complexity region	538	549	N/A	INTRINSIC
coiled coil region	574	600	N/A	INTRINSIC
Pfam:EST1	637	742	1.8e-18	PFAM
Pfam:EST1_DNA_bind	750	1106	1.6e-78	PFAM
coiled coil region	1197	1234	N/A	INTRINSIC
PINc	1245	1396	2.85e-25	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000130145
AA Change: I169S

SMART Domains

Protein: ENSMUSP00000120229
Gene: ENSMUSG00000038290
AA Change: I169S

Domain	Start	End	E-Value	Type
coiled coil region	35	61	N/A	INTRINSIC
Pfam:EST1	99	204	1.3e-19	PFAM
Pfam:EST1_DNA_bind	212	339	7.3e-37	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158094

Meta Mutation Damage Score

0.5917

Coding Region Coverage

1x: 0.0%
3x: 0.0%
10x: 0.0%
20x: 0.0%

Validation Efficiency

90% (46/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the telomerase ribonucleoprotein complex responsible for the replication and maintenance of chromosome ends. The encoded protein also plays a role in the nonsense-mediated mRNA decay (NMD) pathway, providing the endonuclease activity near the premature translation termination codon that is needed to initiate NMD. Alternatively spliced transcript variants encoding distinct protein isoforms have been described. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygosity for insertion of a transgene into intron 6 of the gene results in embryonic lethality. Mice homozygous for a knock-out allele exhibit prenatal lethality. Mice homozygous for a conditional allele activated in embryonic stem cells exhibit defective telomere maintenance and NMD. [provided by MGI curators]

Allele List at MGI

All alleles(52) : Gene trapped(52)

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933416I08Rik	TCC	TCCC	X: 53,690,895		noncoding transcript	Het
Adcy9	T	C	16: 4,418,066	T257A	possibly damaging	Het
Ahnak	A	G	19: 9,002,387	D345G	probably benign	Het
Ak5	A	G	3: 152,660,514		probably null	Het
Akap3	A	G	6: 126,866,416	K666R	probably damaging	Het
Alpk3	A	G	7: 81,093,909	N1158S	probably benign	Het
Atp23	A	T	10: 126,887,687	V182E	probably damaging	Het
Atp4a	A	G	7: 30,723,037	D898G	probably benign	Het
Bnip3	T	C	7: 138,894,479	N140S	probably damaging	Het
Bptf	T	C	11: 107,077,680	Y1059C	probably damaging	Het
Cacna1h	A	T	17: 25,391,144	I796N	probably damaging	Het
Ccnb2	A	G	9: 70,409,396		probably benign	Het
Cd3g	T	A	9: 44,970,763	D165V	probably damaging	Het
Cfap70	T	C	14: 20,448,608	T4A	probably benign	Het
Cilp	TGGG	TGG	9: 65,280,130		probably null	Het
Cntn4	C	T	6: 106,353,712	T97M	probably benign	Het
Crb1	CG	C	1: 139,237,086		probably null	Het
Crim1	C	T	17: 78,367,798	T812I	probably benign	Het
Csmd1	G	T	8: 15,945,127	T2636K	probably damaging	Het
Cyp39a1	T	A	17: 43,683,050	Y200*	probably null	Het
Dlg4	T	G	11: 70,042,202	I478S	probably damaging	Het
Dsc3	A	T	18: 19,974,048	N505K	probably benign	Het
Efhc1	T	C	1: 20,972,825	W323R	probably damaging	Het
Ehhadh	T	A	16: 21,762,770	I491L	probably benign	Het
Ggt6	T	G	11: 72,436,813	H148Q	possibly damaging	Het
Gstm3	T	C	3: 107,968,801	D25G	probably benign	Het
Gtf2h3	G	A	5: 124,602,168		probably benign	Het
Hjurp	TGGG	TTGCGGG	1: 88,266,280		probably benign	Het
Hnf4g	A	C	3: 3,651,614	E281A	probably damaging	Het
Impg1	T	G	9: 80,379,952	E404A	possibly damaging	Het
Kcna2	T	C	3: 107,105,399	V432A	probably benign	Het
Map3k2	T	G	18: 32,200,017	D81E	probably benign	Het
Mmp1a	TG	TGG	9: 7,465,083		probably null	Het
Mmp9	T	A	2: 164,950,806		probably null	Het
Mroh2a	G	A	1: 88,235,376	R376H	probably benign	Het
Ms4a1	G	T	19: 11,253,192	T215N	probably benign	Het
Pam16	T	C	16: 4,616,594	I111V	probably benign	Het
Pde6c	A	G	19: 38,178,271	T720A	probably damaging	Het
Pgap2	T	C	7: 102,236,227	L100P	probably damaging	Het
Ppl	T	A	16: 5,096,726	S686C	probably damaging	Het
Rnls	A	G	19: 33,138,279		probably benign	Het
Robo3	A	C	9: 37,422,528		probably null	Het
Rptn	G	A	3: 93,397,373	G671D	probably damaging	Het
Slc6a21	C	T	7: 45,288,168	Q628*	probably null	Het
Speer4c	A	C	5: 15,714,216		probably benign	Het
Thap1	C	G	8: 26,162,470	P79A	probably benign	Het
Vmn1r202	G	A	13: 22,501,470	T259I	probably benign	Het

Other mutations in Smg6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00952:Smg6	APN	11	74929148	missense	probably benign
IGL01146:Smg6	APN	11	74930428	nonsense	probably null
IGL01505:Smg6	APN	11	75156291	missense	probably damaging	1.00
IGL01541:Smg6	APN	11	74925944	missense	probably benign	0.43
IGL01636:Smg6	APN	11	74935103	critical splice donor site	probably null
IGL02379:Smg6	APN	11	75053925	missense	probably damaging	1.00
IGL02794:Smg6	APN	11	75053934	missense	probably damaging	0.99
IGL02964:Smg6	APN	11	74930750	critical splice donor site	probably null
IGL03057:Smg6	APN	11	74935434	nonsense	probably null
1mM(1):Smg6	UTSW	11	74934989	splice site	probably benign
PIT4802001:Smg6	UTSW	11	75156165	missense	probably damaging	0.96
R0269:Smg6	UTSW	11	75162931	missense	probably benign
R0344:Smg6	UTSW	11	74929821	missense	probably damaging	1.00
R0437:Smg6	UTSW	11	74929701	missense	probably damaging	1.00
R0452:Smg6	UTSW	11	74930213	missense	probably benign
R0511:Smg6	UTSW	11	74929058	missense	probably damaging	1.00
R0617:Smg6	UTSW	11	75162931	missense	probably benign
R0737:Smg6	UTSW	11	75159836	missense	probably damaging	1.00
R1715:Smg6	UTSW	11	74929430	missense	probably benign
R1780:Smg6	UTSW	11	74946116	missense	probably damaging	1.00
R1927:Smg6	UTSW	11	75142848	missense	probably damaging	1.00
R2073:Smg6	UTSW	11	74930294	missense	probably damaging	1.00
R2171:Smg6	UTSW	11	75038646	missense	probably damaging	1.00
R2513:Smg6	UTSW	11	74929676	missense	probably damaging	1.00
R3943:Smg6	UTSW	11	74929541	missense	probably damaging	1.00
R3944:Smg6	UTSW	11	74929541	missense	probably damaging	1.00
R4275:Smg6	UTSW	11	74993874	intron	probably benign
R4369:Smg6	UTSW	11	74932443	nonsense	probably null
R4452:Smg6	UTSW	11	74990141	missense	probably benign	0.14
R4864:Smg6	UTSW	11	74930162	missense	possibly damaging	0.89
R4885:Smg6	UTSW	11	75041918	missense	probably damaging	1.00
R5043:Smg6	UTSW	11	74929895	missense	possibly damaging	0.86
R5189:Smg6	UTSW	11	75041996	missense	probably damaging	1.00
R5378:Smg6	UTSW	11	75041994	missense	possibly damaging	0.61
R5518:Smg6	UTSW	11	75053898	missense	probably damaging	0.99
R5725:Smg6	UTSW	11	74930613	missense	probably benign	0.45
R5746:Smg6	UTSW	11	75139287	missense	probably damaging	1.00
R6151:Smg6	UTSW	11	75156207	missense	probably damaging	0.96
R6319:Smg6	UTSW	11	75156222	missense	probably damaging	1.00
R6349:Smg6	UTSW	11	75053774	missense	possibly damaging	0.94
R6500:Smg6	UTSW	11	74930505	missense	possibly damaging	0.74
R6619:Smg6	UTSW	11	74932453	critical splice donor site	probably null
R6820:Smg6	UTSW	11	75041964	missense	probably damaging	0.99
R6923:Smg6	UTSW	11	74929343	missense	possibly damaging	0.50
R7361:Smg6	UTSW	11	74930153	missense	probably benign	0.00
R7494:Smg6	UTSW	11	74929623	missense	probably benign
R7498:Smg6	UTSW	11	74929106	missense	probably benign	0.01
R7681:Smg6	UTSW	11	74931705	missense	probably damaging	1.00
R7710:Smg6	UTSW	11	74930619	missense	probably benign	0.26
R7770:Smg6	UTSW	11	74993861	missense	unknown
R8159:Smg6	UTSW	11	75038639	missense	probably damaging	1.00
R8381:Smg6	UTSW	11	74931740	missense	probably damaging	1.00
R8463:Smg6	UTSW	11	74930060	missense	probably benign	0.14
R8509:Smg6	UTSW	11	75041876	missense	probably benign	0.04
R8557:Smg6	UTSW	11	75156238	missense	probably damaging	0.98
R8743:Smg6	UTSW	11	74930033	missense	probably benign
R9240:Smg6	UTSW	11	74935058	missense	probably damaging	1.00
R9312:Smg6	UTSW	11	74930051	missense	probably benign	0.27
X0018:Smg6	UTSW	11	74929986	missense	possibly damaging	0.76
Z1186:Smg6	UTSW	11	75156266	missense	probably benign	0.06
Z1187:Smg6	UTSW	11	75156266	missense	probably benign	0.06
Z1188:Smg6	UTSW	11	75156266	missense	probably benign	0.06
Z1189:Smg6	UTSW	11	75156266	missense	probably benign	0.06
Z1190:Smg6	UTSW	11	75156266	missense	probably benign	0.06
Z1191:Smg6	UTSW	11	75156266	missense	probably benign	0.06
Z1192:Smg6	UTSW	11	75156266	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- AAAGGGTTGTTTGGCCAAGGAT -3'
(R):5'- TCCTGCTTATGACTATTAGTTGTTTG -3'

Sequencing Primer
(F):5'- GGGCAGTGACTTCTTTGAT -3'
(R):5'- AGAGGCCCTGAGTTCAATTC -3'

Posted On

2017-01-31