Incidental Mutation 'R0554:Itgav'
ID45323
Institutional Source Beutler Lab
Gene Symbol Itgav
Ensembl Gene ENSMUSG00000027087
Gene Nameintegrin alpha V
Synonymsalphav-integrin, CD51, 1110004F14Rik, 2610028E01Rik, vitronectin receptor alpha polypeptide (VNRA), D430040G12Rik
MMRRC Submission 038746-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0554 (G1)
Quality Score89
Status Not validated
Chromosome2
Chromosomal Location83724397-83806916 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 83794270 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 735 (S735A)
Ref Sequence ENSEMBL: ENSMUSP00000028499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028499] [ENSMUST00000111740]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028499
AA Change: S735A

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000028499
Gene: ENSMUSG00000027087
AA Change: S735A

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Int_alpha 45 104 1.05e-3 SMART
Int_alpha 248 298 4.9e-13 SMART
Int_alpha 302 363 4.55e-8 SMART
Int_alpha 366 422 2.2e-15 SMART
Int_alpha 430 484 1.62e-4 SMART
SCOP:d1m1xa2 629 767 3e-49 SMART
SCOP:d1m1xa3 768 982 1e-89 SMART
low complexity region 995 1008 N/A INTRINSIC
Pfam:Integrin_alpha 1013 1027 3.9e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111740
AA Change: S699A

PolyPhen 2 Score 0.435 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000107369
Gene: ENSMUSG00000027087
AA Change: S699A

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Int_alpha 45 104 1.05e-3 SMART
Int_alpha 212 262 4.9e-13 SMART
Int_alpha 266 327 4.55e-8 SMART
Int_alpha 330 386 2.2e-15 SMART
Int_alpha 394 448 1.62e-4 SMART
SCOP:d1m1xa2 593 731 5e-49 SMART
SCOP:d1m1xa3 732 946 2e-89 SMART
low complexity region 959 972 N/A INTRINSIC
Pfam:Integrin_alpha 977 991 1.3e-7 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that is a member of the integrin superfamily. Integrins are transmembrane receptors involved cell adhesion and signaling, and they are subdivided based on the heterodimer formation of alpha and beta chains. This protein has been shown to heterodimerize with beta 1, beta 3, beta 6 and beta 8. The heterodimer of alpha v and beta 3 forms the Vitronectin receptor. This protein interacts with several extracellular matrix proteins to mediate cell adhesion and may play a role in cell migration. In mouse, deficiency of this gene is associated with defects in vascular morphogenesis in the brain and early post-natal death. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit placental defects, intracerebral and intestinal hemorrhages, and cleft palate, resulting in death occurring as early as midgestation and as late as shortly after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T A 5: 145,045,371 Y255* probably null Het
1810024B03Rik A G 2: 127,187,276 M1T probably null Het
4930503L19Rik T C 18: 70,467,380 D386G probably damaging Het
Ace2 T A X: 164,175,951 N601K probably benign Het
Adam4 A C 12: 81,421,424 I141R probably damaging Het
Adcy10 G A 1: 165,513,130 G235S probably benign Het
Adcy5 G A 16: 35,294,017 V997I probably benign Het
Aff2 T G X: 69,864,074 W1221G possibly damaging Het
Ankrd44 T C 1: 54,763,758 N194D probably benign Het
Apba2 T G 7: 64,745,780 L668R probably damaging Het
Asph T C 4: 9,604,581 D152G probably damaging Het
Bcl3 C G 7: 19,820,066 V126L probably benign Het
Cd163 A G 6: 124,312,660 T446A probably benign Het
Cd209g C T 8: 4,134,995 probably benign Het
Cdadc1 A T 14: 59,586,452 V197E probably damaging Het
CN725425 T C 15: 91,260,763 C610R possibly damaging Het
Col6a2 A G 10: 76,611,161 probably null Het
Coro7 A G 16: 4,632,257 L576P possibly damaging Het
Dgkb T A 12: 38,216,031 V503E probably benign Het
Dhx57 A T 17: 80,260,236 L806* probably null Het
Dlec1 T C 9: 119,115,002 V373A probably benign Het
Dnah11 G T 12: 117,931,178 R3645S probably benign Het
Dnhd1 T C 7: 105,694,395 S1649P probably benign Het
Draxin T G 4: 148,107,963 K297N probably damaging Het
Epha7 T C 4: 28,951,401 S841P probably damaging Het
Esp8 T G 17: 40,530,275 D142E unknown Het
F5 T G 1: 164,179,449 V274G probably damaging Het
Fancc T C 13: 63,317,469 S475G probably benign Het
Fmo3 T C 1: 162,954,332 N484S probably benign Het
Focad T C 4: 88,348,889 Y1046H unknown Het
Furin C T 7: 80,391,284 G602D probably damaging Het
Fut8 A T 12: 77,364,970 I69L probably benign Het
Gm10436 T C 12: 88,177,558 T162A probably benign Het
Gm4951 G A 18: 60,245,417 R8H probably benign Het
Gnai3 A G 3: 108,123,612 I78T probably benign Het
Gpr182 T C 10: 127,751,071 I4V probably benign Het
Gpr63 T C 4: 25,007,447 M57T probably benign Het
Grm1 T A 10: 10,719,923 T654S probably benign Het
Gtf2h4 T C 17: 35,668,639 T371A probably benign Het
Helq T C 5: 100,790,200 N460S probably benign Het
Hmcn1 T C 1: 150,719,117 N1867S probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Inpp5j A G 11: 3,499,644 Y713H probably damaging Het
Ints6 A T 14: 62,704,751 V511D possibly damaging Het
Itga4 A G 2: 79,279,117 Y220C probably damaging Het
Kctd16 A G 18: 40,258,439 I27V probably benign Het
Klhl6 T C 16: 19,953,593 E334G probably damaging Het
Lrmp G A 6: 145,165,287 A237T probably benign Het
Ltbp1 T A 17: 75,225,279 L116H probably damaging Het
Magohb T A 6: 131,285,697 H98L probably benign Het
Mgat2 A G 12: 69,185,392 T247A probably benign Het
Mtif2 G A 11: 29,533,398 probably null Het
Myrfl T C 10: 116,828,973 E384G probably damaging Het
Nfam1 G T 15: 83,033,209 R8S probably benign Het
Numa1 T C 7: 101,995,524 S236P possibly damaging Het
Olfr1022 T C 2: 85,869,519 F309S probably benign Het
Olfr310 A T 7: 86,269,657 I44N probably damaging Het
Olfr317 T C 11: 58,733,039 N42S probably damaging Het
Olfr777 T C 10: 129,268,499 T275A probably benign Het
Orc4 C T 2: 48,905,421 S431N probably benign Het
Pax2 T C 19: 44,761,861 V129A probably damaging Het
Pcdhb15 A G 18: 37,474,519 D268G probably damaging Het
Pdcd1 G A 1: 94,039,382 R264C probably damaging Het
Pi15 T A 1: 17,621,648 M187K probably benign Het
Plag1 C T 4: 3,904,546 C215Y probably damaging Het
Plagl1 A G 10: 13,127,182 T65A probably benign Het
Prss48 T A 3: 86,000,921 Q18L probably benign Het
Prune2 T A 19: 17,125,218 C2580* probably null Het
Rab40b T A 11: 121,359,606 Q74L probably damaging Het
Raf1 A G 6: 115,623,530 I376T probably benign Het
Rbm46 A T 3: 82,865,268 F186I probably damaging Het
Reps1 C T 10: 18,123,119 T720M possibly damaging Het
Rgs22 A G 15: 36,054,709 M649T probably benign Het
Rhot1 C T 11: 80,243,438 R47* probably null Het
Rhox2f A G X: 37,571,471 Y8C possibly damaging Het
Rnf17 A G 14: 56,522,550 Y1604C probably damaging Het
Rnf40 T C 7: 127,602,584 C943R probably damaging Het
Ropn1l A T 15: 31,451,149 M63K probably benign Het
Sbf2 C A 7: 110,428,287 V501F probably damaging Het
Sh3bp1 T A 15: 78,907,267 M354K probably damaging Het
Sipa1l3 T C 7: 29,388,030 H590R possibly damaging Het
Slco6d1 T A 1: 98,466,697 C369S probably benign Het
Sulf1 T C 1: 12,805,194 Y143H probably damaging Het
Tiam2 A T 17: 3,438,681 R755* probably null Het
Trim12c C A 7: 104,344,962 L228F probably damaging Het
Ttc23l G T 15: 10,530,657 Q290K probably benign Het
Uba3 T C 6: 97,191,260 probably null Het
Ugt1a10 A G 1: 88,056,095 E205G probably damaging Het
Ugt3a2 T A 15: 9,351,120 S72T probably benign Het
Upk3bl C T 5: 136,059,794 T113I probably damaging Het
Uspl1 T A 5: 149,187,834 D20E probably damaging Het
Vmn2r19 G A 6: 123,336,143 G724E probably damaging Het
Vmn2r63 T A 7: 42,933,705 K29* probably null Het
Vwf C T 6: 125,642,781 A1474V probably benign Het
Xpc C T 6: 91,491,226 A860T probably benign Het
Zfp462 A G 4: 55,013,689 H737R probably damaging Het
Zfp536 T C 7: 37,480,819 D787G probably damaging Het
Zfp692 A G 11: 58,314,227 H434R probably damaging Het
Zp1 C A 19: 10,920,562 C5F probably benign Het
Other mutations in Itgav
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Itgav APN 2 83802995 missense probably damaging 1.00
IGL01969:Itgav APN 2 83803283 missense probably damaging 1.00
IGL02371:Itgav APN 2 83770053 missense probably damaging 1.00
IGL02563:Itgav APN 2 83771236 missense probably benign
IGL02640:Itgav APN 2 83791939 missense probably benign 0.33
IGL02641:Itgav APN 2 83768345 splice site probably benign
IGL02927:Itgav APN 2 83795540 missense probably damaging 1.00
IGL03172:Itgav APN 2 83765846 missense possibly damaging 0.51
R0158:Itgav UTSW 2 83792037 missense probably benign 0.33
R0346:Itgav UTSW 2 83792609 missense probably damaging 1.00
R0508:Itgav UTSW 2 83792658 splice site probably benign
R0546:Itgav UTSW 2 83803242 missense probably benign 0.04
R1122:Itgav UTSW 2 83791939 missense probably benign 0.33
R1468:Itgav UTSW 2 83765901 splice site probably benign
R1566:Itgav UTSW 2 83736630 missense probably damaging 1.00
R1657:Itgav UTSW 2 83801779 missense probably benign 0.21
R1892:Itgav UTSW 2 83771336 missense probably damaging 1.00
R1912:Itgav UTSW 2 83795486 missense possibly damaging 0.85
R2176:Itgav UTSW 2 83803255 missense probably damaging 1.00
R2438:Itgav UTSW 2 83776542 missense probably damaging 1.00
R2449:Itgav UTSW 2 83768750 critical splice donor site probably null
R3110:Itgav UTSW 2 83792571 nonsense probably null
R3112:Itgav UTSW 2 83792571 nonsense probably null
R3176:Itgav UTSW 2 83776542 missense probably damaging 1.00
R3177:Itgav UTSW 2 83776542 missense probably damaging 1.00
R3276:Itgav UTSW 2 83776542 missense probably damaging 1.00
R3277:Itgav UTSW 2 83776542 missense probably damaging 1.00
R3766:Itgav UTSW 2 83801885 critical splice donor site probably null
R3774:Itgav UTSW 2 83791964 missense probably damaging 1.00
R3880:Itgav UTSW 2 83768301 missense probably damaging 1.00
R4196:Itgav UTSW 2 83768327 missense probably benign 0.24
R4287:Itgav UTSW 2 83724840 nonsense probably null
R4620:Itgav UTSW 2 83755902 missense probably benign 0.07
R4790:Itgav UTSW 2 83755810 missense probably damaging 1.00
R4946:Itgav UTSW 2 83788983 missense probably benign 0.16
R6150:Itgav UTSW 2 83776436 missense probably benign
R6345:Itgav UTSW 2 83802036 missense probably damaging 1.00
R6482:Itgav UTSW 2 83794270 missense probably damaging 1.00
R6900:Itgav UTSW 2 83803247 missense probably damaging 1.00
R7247:Itgav UTSW 2 83724835 missense probably damaging 0.98
R7317:Itgav UTSW 2 83794983 missense probably benign 0.12
R7429:Itgav UTSW 2 83794258 missense probably damaging 1.00
R7430:Itgav UTSW 2 83794258 missense probably damaging 1.00
R7522:Itgav UTSW 2 83802029 missense probably benign 0.10
R7546:Itgav UTSW 2 83776550 nonsense probably null
V1662:Itgav UTSW 2 83783854 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TGTGCATTGCTTTCACTGGAACAAC -3'
(R):5'- ACTGAAGCCCTACCGATCAACCAATTAT -3'

Sequencing Primer
(F):5'- ATAGCCTCCATTATGACTTCAGTG -3'
(R):5'- tccatttccagcacccac -3'
Posted On2013-06-11