Mutagenetix > Incidental Mutations

Incidental Mutation 'IGL03097:Cacna1h'

453237

Institutional Source

Beutler Lab

Gene Symbol

Cacna1h

Ensembl Gene

ENSMUSG00000024112

Gene Name

calcium channel, voltage-dependent, T type, alpha 1H subunit

Synonyms

Cav3.2, alpha13.2, T-type Cav3.2

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

IGL03097 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

25374285-25433783 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 25391144 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 796 (I796N)

Ref Sequence

ENSEMBL: ENSMUSP00000125541 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078496] [ENSMUST00000159048] [ENSMUST00000159610]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000078496
AA Change: I796N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000077586
Gene: ENSMUSG00000024112
AA Change: I796N

Domain	Start	End	E-Value	Type
low complexity region	16	36	N/A	INTRINSIC
Pfam:Ion_trans	138	418	8.4e-65	PFAM
low complexity region	500	511	N/A	INTRINSIC
low complexity region	515	531	N/A	INTRINSIC
low complexity region	557	568	N/A	INTRINSIC
low complexity region	708	723	N/A	INTRINSIC
Pfam:Ion_trans	824	1011	4.7e-46	PFAM
low complexity region	1130	1147	N/A	INTRINSIC
low complexity region	1248	1259	N/A	INTRINSIC
Pfam:Ion_trans	1341	1565	4.5e-56	PFAM
low complexity region	1576	1602	N/A	INTRINSIC
Pfam:Ion_trans	1656	1864	7.8e-48	PFAM
Pfam:PKD_channel	1714	1871	1.2e-10	PFAM
Blast:Tryp_SPc	1915	2077	1e-38	BLAST
low complexity region	2086	2097	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000159048
AA Change: I690N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000123741
Gene: ENSMUSG00000024112
AA Change: I690N

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	32	312	8e-65	PFAM
low complexity region	394	405	N/A	INTRINSIC
low complexity region	409	425	N/A	INTRINSIC
low complexity region	451	462	N/A	INTRINSIC
low complexity region	602	617	N/A	INTRINSIC
Pfam:Ion_trans	718	905	4.6e-46	PFAM
low complexity region	1024	1041	N/A	INTRINSIC
low complexity region	1142	1153	N/A	INTRINSIC
Pfam:Ion_trans	1235	1459	4.3e-56	PFAM
low complexity region	1470	1496	N/A	INTRINSIC
Pfam:PKD_channel	1524	1608	1.6e-6	PFAM
Pfam:Ion_trans	1550	1758	7.6e-48	PFAM
Pfam:PKD_channel	1609	1765	1.2e-10	PFAM
Blast:Tryp_SPc	1809	1854	9e-6	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000159610
AA Change: I796N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000125541
Gene: ENSMUSG00000024112
AA Change: I796N

Domain	Start	End	E-Value	Type
low complexity region	16	36	N/A	INTRINSIC
Pfam:Ion_trans	99	430	7e-79	PFAM
low complexity region	500	511	N/A	INTRINSIC
low complexity region	515	531	N/A	INTRINSIC
low complexity region	557	568	N/A	INTRINSIC
low complexity region	708	723	N/A	INTRINSIC
Pfam:Ion_trans	789	1023	2.4e-58	PFAM
low complexity region	1130	1147	N/A	INTRINSIC
low complexity region	1248	1259	N/A	INTRINSIC
Pfam:Ion_trans	1304	1577	4.5e-65	PFAM
Pfam:Ion_trans	1621	1876	4.2e-59	PFAM
Pfam:PKD_channel	1629	1715	9.3e-7	PFAM
Pfam:PKD_channel	1713	1871	2.2e-11	PFAM
Blast:Tryp_SPc	1915	2077	1e-38	BLAST
low complexity region	2086	2097	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161454

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162820

Meta Mutation Damage Score

0.2436

Coding Region Coverage

1x: 0.0%
3x: 0.0%
10x: 0.0%
20x: 0.0%

Validation Efficiency

90% (46/51)

MGI Phenotype

FUNCTION: Voltage-dependent Ca(2+) channels mediate the entry of Ca(2+) ions into excitable cells and are involved in a variety of Ca(2+)-dependent processes, including muscle contraction, hormone or neurotransmitter release, and gene expression. The protein encoded by this gene is an integral membrane protein that belongs to the calcium channel alpha-1 subunits family. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mutation of this locus results in constitutive coronary arteriole contraction and focal myocardial fibrosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933416I08Rik	TCC	TCCC	X: 53,690,895		noncoding transcript	Het
Adcy9	T	C	16: 4,418,066	T257A	possibly damaging	Het
Ahnak	A	G	19: 9,002,387	D345G	probably benign	Het
Ak5	A	G	3: 152,660,514		probably null	Het
Akap3	A	G	6: 126,866,416	K666R	probably damaging	Het
Alpk3	A	G	7: 81,093,909	N1158S	probably benign	Het
Atp23	A	T	10: 126,887,687	V182E	probably damaging	Het
Atp4a	A	G	7: 30,723,037	D898G	probably benign	Het
Bnip3	T	C	7: 138,894,479	N140S	probably damaging	Het
Bptf	T	C	11: 107,077,680	Y1059C	probably damaging	Het
Ccnb2	A	G	9: 70,409,396		probably benign	Het
Cd3g	T	A	9: 44,970,763	D165V	probably damaging	Het
Cfap70	T	C	14: 20,448,608	T4A	probably benign	Het
Cilp	TGGG	TGG	9: 65,280,130		probably null	Het
Cntn4	C	T	6: 106,353,712	T97M	probably benign	Het
Crb1	CG	C	1: 139,237,086		probably null	Het
Crim1	C	T	17: 78,367,798	T812I	probably benign	Het
Csmd1	G	T	8: 15,945,127	T2636K	probably damaging	Het
Cyp39a1	T	A	17: 43,683,050	Y200*	probably null	Het
Dlg4	T	G	11: 70,042,202	I478S	probably damaging	Het
Dsc3	A	T	18: 19,974,048	N505K	probably benign	Het
Efhc1	T	C	1: 20,972,825	W323R	probably damaging	Het
Ehhadh	T	A	16: 21,762,770	I491L	probably benign	Het
Ggt6	T	G	11: 72,436,813	H148Q	possibly damaging	Het
Gstm3	T	C	3: 107,968,801	D25G	probably benign	Het
Gtf2h3	G	A	5: 124,602,168		probably benign	Het
Hjurp	TGGG	TTGCGGG	1: 88,266,280		probably benign	Het
Hnf4g	A	C	3: 3,651,614	E281A	probably damaging	Het
Impg1	T	G	9: 80,379,952	E404A	possibly damaging	Het
Kcna2	T	C	3: 107,105,399	V432A	probably benign	Het
Map3k2	T	G	18: 32,200,017	D81E	probably benign	Het
Mmp1a	TG	TGG	9: 7,465,083		probably null	Het
Mmp9	T	A	2: 164,950,806		probably null	Het
Mroh2a	G	A	1: 88,235,376	R376H	probably benign	Het
Ms4a1	G	T	19: 11,253,192	T215N	probably benign	Het
Pam16	T	C	16: 4,616,594	I111V	probably benign	Het
Pde6c	A	G	19: 38,178,271	T720A	probably damaging	Het
Pgap2	T	C	7: 102,236,227	L100P	probably damaging	Het
Ppl	T	A	16: 5,096,726	S686C	probably damaging	Het
Rnls	A	G	19: 33,138,279		probably benign	Het
Robo3	A	C	9: 37,422,528		probably null	Het
Rptn	G	A	3: 93,397,373	G671D	probably damaging	Het
Slc6a21	C	T	7: 45,288,168	Q628*	probably null	Het
Smg6	T	G	11: 74,932,426	I708S	probably damaging	Het
Speer4c	A	C	5: 15,714,216		probably benign	Het
Thap1	C	G	8: 26,162,470	P79A	probably benign	Het
Vmn1r202	G	A	13: 22,501,470	T259I	probably benign	Het

Other mutations in Cacna1h

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00505:Cacna1h	APN	17	25381508	missense	probably damaging	1.00
IGL01412:Cacna1h	APN	17	25391950	missense	probably benign	0.24
IGL01625:Cacna1h	APN	17	25383485	missense	probably damaging	0.97
IGL01625:Cacna1h	APN	17	25385712	missense	possibly damaging	0.95
IGL01684:Cacna1h	APN	17	25388716	missense	probably damaging	1.00
IGL01862:Cacna1h	APN	17	25383483	missense	probably damaging	1.00
IGL01877:Cacna1h	APN	17	25388050	missense	probably damaging	1.00
IGL02040:Cacna1h	APN	17	25397611	missense	probably benign	0.10
IGL02190:Cacna1h	APN	17	25433026	missense	probably benign
IGL02686:Cacna1h	APN	17	25385749	missense	possibly damaging	0.80
IGL02883:Cacna1h	APN	17	25380532	missense	probably damaging	1.00
IGL02945:Cacna1h	APN	17	25388059	missense	probably damaging	1.00
IGL03025:Cacna1h	APN	17	25432894	nonsense	probably null
IGL03095:Cacna1h	APN	17	25383778	unclassified	probably benign
IGL03207:Cacna1h	APN	17	25391333	missense	probably damaging	1.00
IGL02991:Cacna1h	UTSW	17	25391312	missense	possibly damaging	0.56
R0010:Cacna1h	UTSW	17	25380844	missense	probably damaging	1.00
R0194:Cacna1h	UTSW	17	25380924	unclassified	probably benign
R0361:Cacna1h	UTSW	17	25389422	missense	probably damaging	1.00
R0501:Cacna1h	UTSW	17	25388667	missense	probably damaging	1.00
R0558:Cacna1h	UTSW	17	25381550	missense	probably damaging	1.00
R0588:Cacna1h	UTSW	17	25387564	missense	probably damaging	1.00
R0626:Cacna1h	UTSW	17	25393546	missense	possibly damaging	0.92
R0811:Cacna1h	UTSW	17	25388628	missense	probably damaging	1.00
R0812:Cacna1h	UTSW	17	25388628	missense	probably damaging	1.00
R0964:Cacna1h	UTSW	17	25378775	unclassified	probably benign
R1351:Cacna1h	UTSW	17	25391951	missense	probably benign	0.14
R1457:Cacna1h	UTSW	17	25397620	missense	probably damaging	1.00
R1521:Cacna1h	UTSW	17	25397354	missense	possibly damaging	0.57
R1564:Cacna1h	UTSW	17	25377861	nonsense	probably null
R1611:Cacna1h	UTSW	17	25381471	missense	probably damaging	1.00
R1669:Cacna1h	UTSW	17	25383471	missense	probably damaging	1.00
R1835:Cacna1h	UTSW	17	25392076	missense	probably benign	0.01
R1858:Cacna1h	UTSW	17	25380807	missense	probably damaging	1.00
R1887:Cacna1h	UTSW	17	25376887	missense	probably benign	0.01
R2039:Cacna1h	UTSW	17	25391845	missense	probably benign	0.03
R2091:Cacna1h	UTSW	17	25432876	missense	possibly damaging	0.95
R2133:Cacna1h	UTSW	17	25383528	missense	probably damaging	1.00
R2203:Cacna1h	UTSW	17	25380260	missense	probably damaging	1.00
R2205:Cacna1h	UTSW	17	25380260	missense	probably damaging	1.00
R2206:Cacna1h	UTSW	17	25385013	missense	probably benign	0.10
R2207:Cacna1h	UTSW	17	25385013	missense	probably benign	0.10
R2224:Cacna1h	UTSW	17	25385943	missense	probably benign	0.03
R2226:Cacna1h	UTSW	17	25385943	missense	probably benign	0.03
R2261:Cacna1h	UTSW	17	25433165	missense	possibly damaging	0.91
R2361:Cacna1h	UTSW	17	25384012	missense	probably damaging	1.00
R2917:Cacna1h	UTSW	17	25395452	missense	probably damaging	0.97
R3031:Cacna1h	UTSW	17	25433134	missense	probably damaging	0.99
R3856:Cacna1h	UTSW	17	25392453	missense	probably damaging	1.00
R4230:Cacna1h	UTSW	17	25387863	missense	probably damaging	1.00
R4408:Cacna1h	UTSW	17	25380627	missense	probably damaging	1.00
R4687:Cacna1h	UTSW	17	25393910	missense	possibly damaging	0.47
R4887:Cacna1h	UTSW	17	25377287	missense	possibly damaging	0.86
R4895:Cacna1h	UTSW	17	25389422	missense	probably damaging	0.99
R5067:Cacna1h	UTSW	17	25397808	missense	probably damaging	1.00
R5077:Cacna1h	UTSW	17	25375250	missense	probably benign	0.02
R5148:Cacna1h	UTSW	17	25387545	missense	probably damaging	1.00
R5336:Cacna1h	UTSW	17	25392231	missense	probably damaging	0.99
R5450:Cacna1h	UTSW	17	25383186	missense	probably damaging	1.00
R5616:Cacna1h	UTSW	17	25377667	missense	probably damaging	1.00
R5738:Cacna1h	UTSW	17	25387049	missense	probably damaging	0.99
R5883:Cacna1h	UTSW	17	25376922	missense	probably benign	0.00
R5954:Cacna1h	UTSW	17	25383201	missense	probably damaging	1.00
R5961:Cacna1h	UTSW	17	25377272	missense	probably benign	0.01
R6110:Cacna1h	UTSW	17	25391276	missense	probably benign	0.10
R6125:Cacna1h	UTSW	17	25385694	missense	probably benign	0.00
R6189:Cacna1h	UTSW	17	25397844	missense	probably damaging	1.00
R6216:Cacna1h	UTSW	17	25378819	missense	probably damaging	1.00
R6259:Cacna1h	UTSW	17	25397656	critical splice acceptor site	probably null
R6296:Cacna1h	UTSW	17	25383079	missense	probably damaging	1.00
R6394:Cacna1h	UTSW	17	25387481	missense	probably benign	0.32
R6695:Cacna1h	UTSW	17	25393740	missense	probably damaging	1.00
R6746:Cacna1h	UTSW	17	25381550	missense	probably damaging	1.00
R6914:Cacna1h	UTSW	17	25385039	missense	probably benign
R6942:Cacna1h	UTSW	17	25385039	missense	probably benign
R6955:Cacna1h	UTSW	17	25388056	missense	probably damaging	1.00
R7041:Cacna1h	UTSW	17	25394003	missense	probably damaging	0.98
R7120:Cacna1h	UTSW	17	25391507	missense	probably benign	0.31
R7125:Cacna1h	UTSW	17	25383536	missense	probably damaging	0.99
R7182:Cacna1h	UTSW	17	25377655	missense	probably damaging	1.00
R7270:Cacna1h	UTSW	17	25384765	missense	probably damaging	1.00
R7274:Cacna1h	UTSW	17	25378837	missense	probably damaging	1.00
R7319:Cacna1h	UTSW	17	25389461	missense	possibly damaging	0.94
R7406:Cacna1h	UTSW	17	25385626	missense	possibly damaging	0.56
R7634:Cacna1h	UTSW	17	25392109	missense	possibly damaging	0.87
R7684:Cacna1h	UTSW	17	25389372	missense	probably damaging	0.99
R7769:Cacna1h	UTSW	17	25385805	missense	probably damaging	1.00
R7856:Cacna1h	UTSW	17	25389477	missense	probably damaging	0.98
R7876:Cacna1h	UTSW	17	25375251	missense	probably benign
R7898:Cacna1h	UTSW	17	25392276	missense	probably damaging	1.00
R8038:Cacna1h	UTSW	17	25375891	missense	probably damaging	0.97
R8042:Cacna1h	UTSW	17	25392471	nonsense	probably null
R8139:Cacna1h	UTSW	17	25383723	missense	probably damaging	1.00
R8391:Cacna1h	UTSW	17	25377230	missense	probably benign	0.00
R8795:Cacna1h	UTSW	17	25393564	missense	probably damaging	1.00
R9227:Cacna1h	UTSW	17	25380882	missense	probably damaging	1.00
R9230:Cacna1h	UTSW	17	25380882	missense	probably damaging	1.00
R9236:Cacna1h	UTSW	17	25381450	missense	probably damaging	1.00
R9360:Cacna1h	UTSW	17	25375362	missense	probably benign	0.00
R9476:Cacna1h	UTSW	17	25392550	missense	probably damaging	1.00
V1662:Cacna1h	UTSW	17	25377309	missense	possibly damaging	0.68
Z1176:Cacna1h	UTSW	17	25391250	missense	probably benign
Z1177:Cacna1h	UTSW	17	25375892	missense	probably damaging	1.00
Z1177:Cacna1h	UTSW	17	25391378	missense	probably damaging	0.99
Z1177:Cacna1h	UTSW	17	25393584	missense	probably benign	0.15

Predicted Primers

PCR Primer
(F):5'- TCAGGAAGAGGCTAGCAATTC -3'
(R):5'- GTTTACACAGGACGTACGGC -3'

Sequencing Primer
(F):5'- TTCTAGGAAGATACAGGGACCC -3'
(R):5'- CATGGGGATTGCCGAGATC -3'

Posted On

2017-01-31