Mutagenetix > Incidental Mutations

Incidental Mutation 'IGL03097:Crim1'

453239

Institutional Source

Beutler Lab

Gene Symbol

Crim1

Ensembl Gene

ENSMUSG00000024074

Gene Name

cysteine rich transmembrane BMP regulator 1 (chordin like)

Synonyms

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

IGL03097 (G1)

Quality Score

146

Status

Validated

Chromosome

Chromosomal Location

78200248-78376592 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 78367798 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 812 (T812I)

Ref Sequence

ENSEMBL: ENSMUSP00000108117 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112498]

Predicted Effect

probably benign
Transcript: ENSMUST00000112498
AA Change: T812I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000108117
Gene: ENSMUSG00000024074
AA Change: T812I

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
IB	35	111	1.87e-5	SMART
VWC	336	390	6.04e-13	SMART
VWC	403	456	1.15e-9	SMART
Pfam:Antistasin	469	498	4.5e-10	PFAM
Pfam:Antistasin	505	532	1.5e-8	PFAM
Pfam:Antistasin	539	564	5.7e-9	PFAM
Pfam:Antistasin	567	592	1.7e-10	PFAM
VWC	608	662	1.26e-10	SMART
VWC	679	734	1.37e-11	SMART
VWC	753	808	1.46e-11	SMART
VWC	819	873	1.01e-14	SMART
transmembrane domain	940	962	N/A	INTRINSIC

Meta Mutation Damage Score

0.0752

Coding Region Coverage

1x: 0.0%
3x: 0.0%
10x: 0.0%
20x: 0.0%

Validation Efficiency

90% (46/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein containing six cysteine-rich repeat domains and an insulin-like growth factor-binding domain. The encoded protein may play a role in tissue development though interactions with members of the transforming growth factor beta family, such as bone morphogenetic proteins. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mutations in this locus cause perinatal lethality, syndactyly, and eye and kidney abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933416I08Rik	TCC	TCCC	X: 53,690,895		noncoding transcript	Het
Adcy9	T	C	16: 4,418,066	T257A	possibly damaging	Het
Ahnak	A	G	19: 9,002,387	D345G	probably benign	Het
Ak5	A	G	3: 152,660,514		probably null	Het
Akap3	A	G	6: 126,866,416	K666R	probably damaging	Het
Alpk3	A	G	7: 81,093,909	N1158S	probably benign	Het
Atp23	A	T	10: 126,887,687	V182E	probably damaging	Het
Atp4a	A	G	7: 30,723,037	D898G	probably benign	Het
Bnip3	T	C	7: 138,894,479	N140S	probably damaging	Het
Bptf	T	C	11: 107,077,680	Y1059C	probably damaging	Het
Cacna1h	A	T	17: 25,391,144	I796N	probably damaging	Het
Ccnb2	A	G	9: 70,409,396		probably benign	Het
Cd3g	T	A	9: 44,970,763	D165V	probably damaging	Het
Cfap70	T	C	14: 20,448,608	T4A	probably benign	Het
Cilp	TGGG	TGG	9: 65,280,130		probably null	Het
Cntn4	C	T	6: 106,353,712	T97M	probably benign	Het
Crb1	CG	C	1: 139,237,086		probably null	Het
Csmd1	G	T	8: 15,945,127	T2636K	probably damaging	Het
Cyp39a1	T	A	17: 43,683,050	Y200*	probably null	Het
Dlg4	T	G	11: 70,042,202	I478S	probably damaging	Het
Dsc3	A	T	18: 19,974,048	N505K	probably benign	Het
Efhc1	T	C	1: 20,972,825	W323R	probably damaging	Het
Ehhadh	T	A	16: 21,762,770	I491L	probably benign	Het
Ggt6	T	G	11: 72,436,813	H148Q	possibly damaging	Het
Gstm3	T	C	3: 107,968,801	D25G	probably benign	Het
Gtf2h3	G	A	5: 124,602,168		probably benign	Het
Hjurp	TGGG	TTGCGGG	1: 88,266,280		probably benign	Het
Hnf4g	A	C	3: 3,651,614	E281A	probably damaging	Het
Impg1	T	G	9: 80,379,952	E404A	possibly damaging	Het
Kcna2	T	C	3: 107,105,399	V432A	probably benign	Het
Map3k2	T	G	18: 32,200,017	D81E	probably benign	Het
Mmp1a	TG	TGG	9: 7,465,083		probably null	Het
Mmp9	T	A	2: 164,950,806		probably null	Het
Mroh2a	G	A	1: 88,235,376	R376H	probably benign	Het
Ms4a1	G	T	19: 11,253,192	T215N	probably benign	Het
Pam16	T	C	16: 4,616,594	I111V	probably benign	Het
Pde6c	A	G	19: 38,178,271	T720A	probably damaging	Het
Pgap2	T	C	7: 102,236,227	L100P	probably damaging	Het
Ppl	T	A	16: 5,096,726	S686C	probably damaging	Het
Rnls	A	G	19: 33,138,279		probably benign	Het
Robo3	A	C	9: 37,422,528		probably null	Het
Rptn	G	A	3: 93,397,373	G671D	probably damaging	Het
Slc6a21	C	T	7: 45,288,168	Q628*	probably null	Het
Smg6	T	G	11: 74,932,426	I708S	probably damaging	Het
Speer4c	A	C	5: 15,714,216		probably benign	Het
Thap1	C	G	8: 26,162,470	P79A	probably benign	Het
Vmn1r202	G	A	13: 22,501,470	T259I	probably benign	Het

Other mutations in Crim1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00815:Crim1	APN	17	78370091	missense	probably damaging	1.00
IGL01090:Crim1	APN	17	78347229	missense	probably damaging	0.97
IGL01490:Crim1	APN	17	78335296	missense	possibly damaging	0.94
IGL01686:Crim1	APN	17	78344434	missense	probably benign	0.09
IGL01769:Crim1	APN	17	78313235	missense	probably benign	0.02
IGL02004:Crim1	APN	17	78372575	splice site	probably benign
IGL02211:Crim1	APN	17	78355145	missense	probably damaging	1.00
IGL02275:Crim1	APN	17	78369998	missense	possibly damaging	0.56
IGL02408:Crim1	APN	17	78315654	missense	possibly damaging	0.78
IGL02411:Crim1	APN	17	78335334	nonsense	probably null
IGL02453:Crim1	APN	17	78344484	missense	probably damaging	1.00
IGL02481:Crim1	APN	17	78350798	missense	probably damaging	0.98
IGL02632:Crim1	APN	17	78372674	missense	probably benign	0.08
IGL02652:Crim1	APN	17	78315677	missense	probably damaging	1.00
IGL02696:Crim1	APN	17	78279973	missense	probably damaging	0.96
IGL02811:Crim1	APN	17	78350701	missense	possibly damaging	0.62
IGL03105:Crim1	APN	17	78315750	splice site	probably benign
IGL03349:Crim1	APN	17	78355150	nonsense	probably null
bugeye	UTSW	17	78281347	missense	possibly damaging	0.94
R0227:Crim1	UTSW	17	78344509	splice site	probably benign
R0458:Crim1	UTSW	17	78313226	missense	probably damaging	0.98
R0482:Crim1	UTSW	17	78372579	missense	probably benign	0.00
R0989:Crim1	UTSW	17	78200944	missense	probably benign	0.21
R1266:Crim1	UTSW	17	78200833	small deletion	probably benign
R1529:Crim1	UTSW	17	78367954	missense	probably benign
R1679:Crim1	UTSW	17	78200799	missense	probably benign	0.27
R1909:Crim1	UTSW	17	78313127	missense	probably benign	0.26
R2273:Crim1	UTSW	17	78355179	critical splice donor site	probably null
R3899:Crim1	UTSW	17	78281354	missense	probably benign	0.00
R3909:Crim1	UTSW	17	78281239	splice site	probably benign
R4092:Crim1	UTSW	17	78350836	missense	probably damaging	1.00
R4154:Crim1	UTSW	17	78237843	missense	probably benign	0.01
R4687:Crim1	UTSW	17	78303025	missense	probably damaging	1.00
R5022:Crim1	UTSW	17	78280129	missense	possibly damaging	0.95
R5073:Crim1	UTSW	17	78281347	missense	possibly damaging	0.94
R5089:Crim1	UTSW	17	78374090	missense	probably damaging	1.00
R5284:Crim1	UTSW	17	78313266	missense	possibly damaging	0.83
R5461:Crim1	UTSW	17	78237807	missense	probably damaging	1.00
R5635:Crim1	UTSW	17	78315641	missense	probably damaging	1.00
R5686:Crim1	UTSW	17	78374083	missense	possibly damaging	0.63
R5956:Crim1	UTSW	17	78315717	missense	probably damaging	1.00
R6117:Crim1	UTSW	17	78303088	missense	probably damaging	1.00
R6129:Crim1	UTSW	17	78281309	missense	probably benign	0.17
R6265:Crim1	UTSW	17	78370085	missense	probably benign	0.01
R6812:Crim1	UTSW	17	78315600	missense	probably damaging	1.00
R6858:Crim1	UTSW	17	78315627	missense	probably damaging	1.00
R7920:Crim1	UTSW	17	78303064	missense	probably damaging	1.00
R8022:Crim1	UTSW	17	78315555	missense	possibly damaging	0.82
R8434:Crim1	UTSW	17	78347257	missense	probably benign	0.00
X0064:Crim1	UTSW	17	78200833	small deletion	probably benign
Z1088:Crim1	UTSW	17	78367835	missense	probably benign	0.31

Predicted Primers

PCR Primer
(F):5'- GTTCTGAAGGTCCAACGAGAATG -3'
(R):5'- CGCCATATTTGCCTGACCAC -3'

Sequencing Primer
(F):5'- TGACAGACAGCCCTGGAG -3'
(R):5'- ATGGTCTAGATACCTGGGCAC -3'

Posted On

2017-01-31